Molecule Information

General Information of the Molecule (ID: Mol05291)

• Name: hsa-miR-584 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UAGGGUGACCAGCCAUUAUGGUUUGCCUGGGACUGAGGAAUUUGCUGGGAUAUGUCAGUU
  CCAGGCCAACCAGGCUGGUUGGUCUCCCUGAAGCAAC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] [2]

• Resistant Disease: Oral squamous cell carcinoma [ICD-11: 2B6E.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Tca8113 cells; Tongue; Homo sapiens (Human); CVCL_6851
• Experiment for Molecule Alteration: RT-PCR; Western blot
• Experiment for Drug Resistance: Growth inhibition assay
• Mechanism Description: miR-23a is an up-stream regulator of TOP2B to realize the chemoresistance of cisplatin.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [4]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [5]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• Experiment for Molecule Alteration: MiRNA microarray
• Experiment for Drug Resistance: Water-soluble tetrazolium salt (WST)-based assay
• Mechanism Description: We then performed a comprehensive analysis of miRNA expressions in U251R and parental cells using miRNA microarrays. miR-195, miR-455-3p and miR-10a* were the three most up-regulated miRNAs in the resistant cells. Thirteen miRNAs were overexpressed (>2.0-fold) and two were underexpressed (<0.5-fold) in U251R cells compared to U251Wt cells. In addition, using in silico analysis combined with cDNA microarray experiment, we present possible mRNA targets of these miRNAs.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [4]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: Microarray analysis; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MiRNA microarray analysis showed that there were 53 upregulated miRNAs in Huh-7/ADM, 56 in Huh-7/CBP, 58 in Huh-7/DDP, 58 in Huh-7/MMC and 49 in Huh-7/VCR, whereas there were 52 downregulated miRNAs in Huh-7/ADM, 50 in Huh-7/CBP, 41 in Huh-7/DDP, 55 in Huh-7/MMC and 56 in Huh-7/VCR. Moreover, 26 simultaneously upregulated and 25 simultaneously downregulated miRNAs were noted in the Huh-7/ADM, Huh-7/CBP, Huh-7/DDP and Huh-7/MMC sublines compared to the parental Huh-7 cell line. In contrast, among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines. In conclusion, the present study demonstrates that the differentially expressed miRNA profiles in these five drug-resistant HCC sublines could be useful to further investigate the association of miRNA expression with drug resistance in HCC.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: MicroRNAs contribute to the chemoresistance of cisplatin in tongue squamous cell carcinoma lines. Oral Oncol. 2010 Apr;46(4):317-22. doi: 10.1016/j.oraloncology.2010.02.002. Epub 2010 Mar 9.
• Ref 3: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 4: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 5: Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96. doi: 10.1186/1476-4598-9-96.