Molecule Information

General Information of the Molecule (ID: Mol05271)

• Name: hsa-miR-4728 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  GUGGGAGGGGAGAGGCAGCAAGCACACAGGGCCUGGGACUAGCAUGCUGACCUCCCUCCU
  GCCCCAG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.0] [2]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: DDB2-AS1/miR-4728-5p/p53 Axis; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: We observed that quercetin can upregulate the mRNA expression levels of lncRNA DDB2-AS1 and p53 in NSCLC cells and reduce the mRNA expression levels of miR-4728-5p and SLC7A11 simultaneously. The above results indicate that quercetin may induce ferroptosis by regulating the DDB2-AS1/miR-4728-5p axis, thus enhancing the sensitivity of drug-resistant cells to cisplatin.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

References

• Ref 1: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 2: MicroRNA-212-3p inhibits paclitaxel resistance through regulating epithelial-mesenchymal transition, migration and invasion by targeting ZEB2 in human hepatocellular carcinoma. Oncol Lett. 2020 Oct 20(4):23