Molecule Information

General Information of the Molecule (ID: Mol05216)

• Name: hsa-miR-18b ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAGCAGCUUAGAAUCUACUGCCCUAAAUGC
  CCCUUCUGGCA

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: RT-qPCR
• Mechanism Description: This gene is down-regulated in cisplatin-resistance cells

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [3]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is up-regulated in doxorubicin-sensitive cells

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [3]

• Sensitive Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is up-regulated in doxorubicin-sensitive cells

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [ICD-11: 2C94.0] [4]

• Resistant Disease: Bladder cancer [ICD-11: 2C94.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: UM-UC-3 cells; Bladder; Homo sapiens (Human); CVCL_1783
• In Vitro Model: RT4 cells; Bladder; Homo sapiens (Human); CVCL_0036
• In Vitro Model: RT112 cells; Bladder; Homo sapiens (Human); CVCL_1670
• Experiment for Molecule Alteration: Western blot; Microarray Analysis; qRT-PCR
• Experiment for Drug Resistance: Proliferation Assay
• Mechanism Description: Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [5]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase-3 activity assay
• Mechanism Description: Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: BGB-283, a Novel RAF Kinase and EGFR Inhibitor, Displays Potent Antitumor Activity in BRAF-Mutated Colorectal CancersMol Cancer Ther. 2015 Oct;14(10):2187-97. doi: 10.1158/1535-7163.MCT-15-0262. Epub 2015 Jul 24.
• Ref 3: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 4: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 5: MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
• Ref 6: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.