Molecule Information

General Information of the Molecule (ID: Mol05091)

Name	hsa-miR-129-1 ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	GGAUCUUUUUGCGGUCUGGGCUUGCUGUUCCUCUCAACAGUAGUCAGGAAGCCCUUACCC CAAAAAGUAUCU Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

5 drug(s) in total

Click to Show/Hide the Full List of Drugs

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0]				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.0]			Disease Info
Resistant Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		.
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	SGC-7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	5-FU cells	Colon	Homo sapiens (Human)	CVCL_1846
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

Docetaxel

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[2]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Docetaxel			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MDA-MB-231 cells	Breast	Homo sapiens (Human)	CVCL_0062
Experiment for Molecule Alteration	qRT-PCR; Western blot; Dual luciferase assay
Experiment for Drug Resistance	Cell viability assay
Mechanism Description	Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0]				[1]
Resistant Disease	Gastric cancer [ICD-11: 2B72.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		.
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	SGC-7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	5-FU cells	Colon	Homo sapiens (Human)	CVCL_1846
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

Etoposide

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)		Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]			[3]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]		Disease Info
Resistant Drug	Etoposide		Drug Info
Molecule Alteration	Expression	Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
Experiment for Molecule Alteration	qRT-PCR, Reverse Transcription and Running ABC Transporter TLDA
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	Using miRNA microfluidic arrays from ABI, we determined the microRNA profile for MCF7VP cells compared to drug sensitive cells. Multiple miRNAs showed differential expression among the cell lines including hsa-miR-382, hsa-miR-23b and hsa-miR-885-5p, which were up-regulated (>2-fold increase) in MCF7VP cells and hsa-mir-218, hsa-miR-758 and hsa-miR-548d-5p, which were down-regulated (>2-fold decrease) in MCF7VP cells, suggesting that etoposide resistant MCF7 cells have a miRNA profile that is distinct from the MCF7 drug sensitive cell line.

Paclitaxel

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0]				[4]
Resistant Disease	Non-small cell lung cancer [ICD-11: 2C25.0]			Disease Info
Resistant Drug	Paclitaxel			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	H1993 cells	Lymph node	Homo sapiens (Human)	CVCL_1512
	H358 cells	Lung	Homo sapiens (Human)	CVCL_1559
Experiment for Molecule Alteration	qRT-PCR; Western blot
Experiment for Drug Resistance	Cell viability assay; Colony formation assay; Cell cycle analysis; Cell apoptosis and growth rate assays
Mechanism Description	We demonstrated that two of the miRNA inhibitors (miR-133a/b and miR-361-3p) decrease cell survival by activating caspase-3/7-dependent apoptotic pathways and inducing cell cycle arrest in S phase.We demonstrated that two of the miRNA inhibitors (miR-133a/b and miR-361-3p) decrease cell survival by activating caspase-3/7-dependent apoptotic pathways and inducing cell cycle arrest in S phase.The mimic of miR-346, however, does not rescue the cytotoxic effect of the miR-346 inhibitor, suggesting that the cytotoxicity of the miR-346 inhibitor is most likely to be caused by off-target effects of the synthetic oligo rather than knocking down the expression of the endogenous miR-346.

References

Ref 1	VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
Ref 2	miRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat. 2012 Jan;131(2):445-54. doi: 10.1007/s10549-011-1424-3. Epub 2011 Mar 12.
Ref 3	Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
Ref 4	The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
Ref 5	Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.