Molecule Information

General Information of the Molecule (ID: Mol05019)

• Name: hsa-miR-425 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  GAAAGCGCUUUGGAAUGACACGAUCACUCCCGUUGAGUGGGCACCCGAGAAGCCAUCGGG
  AAUGUCGUGUCCGCCCAGUGCUCUUUC

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• Experiment for Molecule Alteration: MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
• Experiment for Drug Resistance: Cell proliferation assay; Flow cytometry
• Mechanism Description: We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: Luciferase reporter assay; qRT-PCR; Western blot assays
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Cell coculture was performed to examine the effects of exosomal miR-425-3p on the sensitivity of recipient A549 cells to cisplatin

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [5]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: RT-PCR; Western blot; Luciferase assay
• Experiment for Drug Resistance: Cytotoxicity assay; Apoptosis assays
• Mechanism Description: Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [4]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: MiRNA microarray analyses, qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.

References

• Ref 1: Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
• Ref 2: Alterations in p53 predict response to preoperative high dose chemotherapy in patients with gastric cancerMol Pathol. 2003 Oct;56(5):286-92. doi: 10.1136/mp.56.5.286.
• Ref 3: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 4: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 5: Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
• Ref 6: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.