Molecule Information

General Information of the Molecule (ID: Mol01761)

• Name: hsa-miR-3163 ,Homo sapiens
• Synonyms: microRNA 3163
• Molecule Type: Mature miRNA
• Sequence: UAUAAAAUGAGGGCAGUAAGAC
• Ensembl ID: ENSG00000266423
• HGNC ID: HGNC:38209
• Mature Accession: MIMAT0015037

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Carboplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [1]

• Sensitive Disease: Retinoblastoma [ICD-11: 2D02.2]
• Sensitive Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [1]

• Sensitive Disease: Retinoblastoma [ICD-11: 2D02.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [1]

• Sensitive Disease: Retinoblastoma [ICD-11: 2D02.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [1]

• Sensitive Disease: Retinoblastoma [ICD-11: 2D02.2]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Retinoblastoma [1]

• Sensitive Disease: Retinoblastoma [ICD-11: 2D02.2]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: WERI-Rb-1 cells; Retina; Homo sapiens (Human); CVCL_1792
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells.

References

• Ref 1: Silencing of ABCG2 by MicroRNA-3163 Inhibits Multidrug Resistance in Retinoblastoma Cancer Stem Cells. J Korean Med Sci. 2016 Jun;31(6):836-42. doi: 10.3346/jkms.2016.31.6.836. Epub 2016 Apr 20.