Molecule Information
General Information of the Molecule (ID: Mol01761)
Name |
hsa-miR-3163
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 3163
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UAUAAAAUGAGGGCAGUAAGAC
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Retinoblastoma | [1] | |||
Sensitive Disease | Retinoblastoma [ICD-11: 2D02.2] | |||
Sensitive Drug | Carboplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | WERI-Rb-1 cells | Retina | Homo sapiens (Human) | CVCL_1792 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Retinoblastoma | [1] | |||
Sensitive Disease | Retinoblastoma [ICD-11: 2D02.2] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | WERI-Rb-1 cells | Retina | Homo sapiens (Human) | CVCL_1792 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Retinoblastoma | [1] | |||
Sensitive Disease | Retinoblastoma [ICD-11: 2D02.2] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | WERI-Rb-1 cells | Retina | Homo sapiens (Human) | CVCL_1792 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Retinoblastoma | [1] | |||
Sensitive Disease | Retinoblastoma [ICD-11: 2D02.2] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | WERI-Rb-1 cells | Retina | Homo sapiens (Human) | CVCL_1792 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Retinoblastoma | [1] | |||
Sensitive Disease | Retinoblastoma [ICD-11: 2D02.2] | |||
Sensitive Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | WERI-Rb-1 cells | Retina | Homo sapiens (Human) | CVCL_1792 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.