Molecule Information
General Information of the Molecule (ID: Mol01736)
Name |
hsa-miR-891b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 891b
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UGCAACUUACCUGAGUCAUUGA
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Investigative Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | N-methyl-n-nitro-n-nitrosoguanidine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCC1806 cells | Breast | Homo sapiens (Human) | CVCL_1258 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Annexin V assay | |||
Mechanism Description | Down-regulation of PARP1 by miR891b sensitizes human breast cancer cells to alkylating chemotherapeutic drugs. miR891b increased the sensitivity of the HCC1806 cells to the cytotoxic effects of MNNG through suppressing cell proliferation and increasing the percentage of apoptotic cells. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.