Molecule Information

General Information of the Molecule (ID: Mol01736)

• Name: hsa-miR-891b ,Homo sapiens
• Synonyms: microRNA 891b
• Molecule Type: Mature miRNA
• Sequence: UGCAACUUACCUGAGUCAUUGA
• Ensembl ID: ENSG00000216064
• HGNC ID: HGNC:33645
• Mature Accession: MIMAT0004913

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [1]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is down-regulated in doxorubicin-sensitive cells

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [1]

• Sensitive Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is down-regulated in doxorubicin-sensitive cells

Investigative Drug(s) 1 drug(s) in total

N-methyl-n-nitro-n-nitrosoguanidine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: N-methyl-n-nitro-n-nitrosoguanidine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC1806 cells; Breast; Homo sapiens (Human); CVCL_1258
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Annexin V assay
• Mechanism Description: Down-regulation of PARP1 by miR891b sensitizes human breast cancer cells to alkylating chemotherapeutic drugs. miR891b increased the sensitivity of the HCC1806 cells to the cytotoxic effects of MNNG through suppressing cell proliferation and increasing the percentage of apoptotic cells.

References

• Ref 1: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 2: Down-regulation of PARP1 by miR-891b sensitizes human breast cancer cells to alkylating chemotherapeutic drugs. Arch Gynecol Obstet. 2017 Sep;296(3):543-549. doi: 10.1007/s00404-017-4444-3. Epub 2017 Jun 28.