General Information of the Molecule (ID: Mol01725)
Name
hsa-miR-508-5p ,Homo sapiens
Synonyms
microRNA 508
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
UACUCCAGAGGGCGUCACUCAUG
    Click to Show/Hide
Ensembl ID
ENSG00000207589
HGNC ID
HGNC:32145
Mature Accession
MIMAT0004778
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The overexpression of miR-508-5p was sufficient to reverse cancer cell resistance to multiple chemotherapeutics in vitro and sensitize tumours to chemotherapy in vivo. Further studies showed that miR-508-5p could directly target the 3'-untranslated regions of ABCB1 and Zinc ribbon domain-containing 1 (ZNRD1), and suppress their expression at the mRNA and protein levels. Meanwhile, the suppression of ZNRD1 led to a decrease in ABCB1.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The overexpression of miR-508-5p was sufficient to reverse cancer cell resistance to multiple chemotherapeutics in vitro and sensitize tumours to chemotherapy in vivo. Further studies showed that miR-508-5p could directly target the 3'-untranslated regions of ABCB1 and Zinc ribbon domain-containing 1 (ZNRD1), and suppress their expression at the mRNA and protein levels. Meanwhile, the suppression of ZNRD1 led to a decrease in ABCB1.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The overexpression of miR-508-5p was sufficient to reverse cancer cell resistance to multiple chemotherapeutics in vitro and sensitize tumours to chemotherapy in vivo. Further studies showed that miR-508-5p could directly target the 3'-untranslated regions of ABCB1 and Zinc ribbon domain-containing 1 (ZNRD1), and suppress their expression at the mRNA and protein levels. Meanwhile, the suppression of ZNRD1 led to a decrease in ABCB1.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The overexpression of miR-508-5p was sufficient to reverse cancer cell resistance to multiple chemotherapeutics in vitro and sensitize tumours to chemotherapy in vivo. Further studies showed that miR-508-5p could directly target the 3'-untranslated regions of ABCB1 and Zinc ribbon domain-containing 1 (ZNRD1), and suppress their expression at the mRNA and protein levels. Meanwhile, the suppression of ZNRD1 led to a decrease in ABCB1.
References
Ref 1 miR-508-5p regulates multidrug resistance of gastric cancer by targeting ABCB1 and ZNRD1. Oncogene. 2014 Jun 19;33(25):3267-76. doi: 10.1038/onc.2013.297. Epub 2013 Jul 29.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.