Molecule Information

General Information of the Molecule (ID: Mol01702)

• Name: hsa-miR-297 ,Homo sapiens
• Synonyms: microRNA 297
• Molecule Type: Mature miRNA
• Sequence: AUGUAUGUGUGCAUGUGCAUG
• Ensembl ID: ENSG00000215961
• HGNC ID: HGNC:33691
• Mature Accession: MIMAT0004450

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT-116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT-116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: miRNA Microarray Analysis; qRT-PCR; Luciferase Activity Assay; Western Blot; Semi-Quantitative RT-PCR
• Experiment for Drug Resistance: Caspase-3 Activity Assay; In Vitro Drug Sensitivity Assay; Flow Cytometric
• Mechanism Description: Taken together, our findings suggest that miR-1915 could play a role in the development of MDR in colorectal carcinoma cells at least in part by modulation of apoptosis via targeting Bcl-2.

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCT-116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT-116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: miRNA Microarray Analysis; qRT-PCR; Luciferase Activity Assay; Western Blot; Semi-Quantitative RT-PCR
• Experiment for Drug Resistance: Caspase-3 Activity Assay; In Vitro Drug Sensitivity Assay; Flow Cytometric
• Mechanism Description: Taken together, our findings suggest that miR-1915 could play a role in the development of MDR in colorectal carcinoma cells at least in part by modulation of apoptosis via targeting Bcl-2.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal carcinoma [ICD-11: 2B91.3] [2]

• Sensitive Disease: Colorectal carcinoma [ICD-11: 2B91.3]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells, miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal carcinoma [ICD-11: 2B91.3] [2]

• Sensitive Disease: Colorectal carcinoma [ICD-11: 2B91.3]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells, miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo.

References

• Ref 1: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 2: miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2. Biochem J. 2012 Sep 1;446(2):291-300. doi: 10.1042/BJ20120386.