General Information of the Molecule (ID: Mol01702)
Name
hsa-miR-297 ,Homo sapiens
Synonyms
microRNA 297
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AUGUAUGUGUGCAUGUGCAUG
    Click to Show/Hide
Ensembl ID
ENSG00000215961
HGNC ID
HGNC:33691
Mature Accession
MIMAT0004450
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Oxaliplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal carcinoma [ICD-11: 2B91.3] [1]
Sensitive Disease Colorectal carcinoma [ICD-11: 2B91.3]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells, miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal carcinoma [ICD-11: 2B91.3] [1]
Sensitive Disease Colorectal carcinoma [ICD-11: 2B91.3]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells, miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo.
References
Ref 1 miR-297 modulates multidrug resistance in human colorectal carcinoma by down-regulating MRP-2. Biochem J. 2012 Sep 1;446(2):291-300. doi: 10.1042/BJ20120386.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.