Molecule Information
General Information of the Molecule (ID: Mol01702)
Name |
hsa-miR-297
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 297
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AUGUAUGUGUGCAUGUGCAUG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal carcinoma | [1] | |||
Sensitive Disease | Colorectal carcinoma [ICD-11: 2B91.3] | |||
Sensitive Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells, miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal carcinoma | [1] | |||
Sensitive Disease | Colorectal carcinoma [ICD-11: 2B91.3] | |||
Sensitive Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | MRP-2 (MDR-associated protein 2) is an important MDR protein in platinum-drug-resistance cells, miR-297 in MDR colorectal carcinoma cells reduced MRP-2 protein level and sensitized these cells to anti-cancer drugs in vitro and in vivo. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.