Molecule Information

General Information of the Molecule (ID: Mol01632)

Name	hsa-miR-378a-3p ,Homo sapiens
Synonyms	microRNA 378a Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	ACUGGACUUGGAGUCAGAAGGC Click to Show/Hide
Ensembl ID	ENSG00000199047
HGNC ID	HGNC:31871
Mature Accession	MIMAT0000732
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

4 drug(s) in total

Click to Show/Hide the Full List of Drugs

Fluorouracil

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]				[1]
Resistant Disease	Esophageal squamous cell carcinoma [ICD-11: 2B70.0]			Disease Info
Resistant Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Down-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	OE19 cells	Esophagus	Homo sapiens (Human)	CVCL_1622
	kYSE410 cells	Esophagus	Homo sapiens (Human)	CVCL_1352
Experiment for Molecule Alteration	qPCR
Mechanism Description	Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0]				[2]
Sensitive Disease	Ovarian cancer [ICD-11: 2C73.0]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell colony		Inhibition	hsa05200
	Cell viability		Inhibition	hsa05200
In Vitro Model	SkOV3 cells	Ovary	Homo sapiens (Human)	CVCL_0532
	HEK293T cells	Kidney	Homo sapiens (Human)	CVCL_0063
	OVCAR3 cells	Ovary	Homo sapiens (Human)	CVCL_0465
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay; Flow cytometry assay
Mechanism Description	miR-378a-3p sensitizes ovarian cancer cells to cisplatin through downregulating MAPk1/GRB2.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0]				[3]
Resistant Disease	Gastric cancer [ICD-11: 2B72.0]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	MAPK signalling pathway		Regulation	N.A.
In Vitro Model	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
Experiment for Molecule Alteration	MiRNA microarray analyses, qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.

Vincristine

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0]				[3]
Resistant Disease	Gastric cancer [ICD-11: 2B72.0]			Disease Info
Resistant Drug	Vincristine			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	MAPK signalling pathway		Regulation	N.A.
In Vitro Model	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
	SGC7901 cells	Gastric	Homo sapiens (Human)	CVCL_0520
Experiment for Molecule Alteration	MiRNA microarray analyses, qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.

References

Ref 1	The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 2	miR-378a-3p sensitizes ovarian cancer cells to cisplatin through targeting MAPK1/GRB2. Biomed Pharmacother. 2018 Nov;107:1410-1417. doi: 10.1016/j.biopha.2018.08.132. Epub 2018 Aug 31.
Ref 3	Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.