Molecule Information

General Information of the Molecule (ID: Mol01632)

• Name: hsa-miR-378a-3p ,Homo sapiens
• Synonyms: microRNA 378a
• Molecule Type: Mature miRNA
• Sequence: ACUGGACUUGGAGUCAGAAGGC
• Ensembl ID: ENSG00000199047
• HGNC ID: HGNC:31871
• Mature Accession: MIMAT0000732

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-378a-3p sensitizes ovarian cancer cells to cisplatin through downregulating MAPk1/GRB2.

References

• Ref 1: miR-378a-3p sensitizes ovarian cancer cells to cisplatin through targeting MAPK1/GRB2. Biomed Pharmacother. 2018 Nov;107:1410-1417. doi: 10.1016/j.biopha.2018.08.132. Epub 2018 Aug 31.