Molecule Information
General Information of the Molecule (ID: Mol01616)
Name |
hsa-miR-193a-3p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 193a
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
AACUGGCCUACAAAGUCCCAGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell viability | Activation | hsa05200 | ||
Mitochondrial signaling pathway | Inhibition | hsa04217 | ||
In Vitro Model | AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 |
MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
KATO-3 cells | Gastric | Homo sapiens (Human) | CVCL_0371 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTS assay; Flow cytometry assay | |||
Mechanism Description | SRSF2, a miR-193a-3p target gene, is downregulated and miR-193a-3p is upregulated, which induces the resistence to cisplatin. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [2] | |||
Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
DNA damage response signaling pathway | Activation | hsa04218 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Among the differentially expressed genes between the chemosensitive (5637) and chemoresistant (H-bc) bladder cancer cell lines, the expression level of the PSEN1 gene (presenilin 1), a key component of the Gamma-secretase, is negatively correlated with chemoresistance. A small interfering RNA mediated repression of the PSEN1 gene suppresses cell apoptosis and de-sensitizes 5637 cells, while overexpression of the presenilin 1 sensitizes H-bc cells to the drug-triggered cell death. As a direct target of microRNA-193a-3p that promotes the multi-chemoresistance of the bladder cancer cell, PSEN1 acts as an important executor for the microRNA-193a-3p's positive impact on the multi-chemoresistance of bladder cancer, probably via its activating effect on DNA damage response pathway. In addition to the mechanistic insights, the key players in this microRNA-193a-3p/PSEN1 axis are likely the diagnostic and/or therapeutic targets for an effective chemotherapy of bladder cancer. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. In contrast, the down-regulation of miR-193a-3p decreased the radioresistance and chemoresistance of ESCC cells. In addition, miR-193a-3p inducing DNA damage has also been demonstrated through measuring the level of gamma-H2AX associated with miR-193a-3p. Moreover, a small interfering RNA(siRNA)-induced repression of the PSEN1 gene had an effect similar to that of miR-193a-3p up-regulation. The above processes also inhibited oesophageal cancer cells apoptosis. These findings suggest that miR-193a-3p contributes to the radiation and chemotherapy resistance of oesophageal carcinoma by down-regulating PSEN1. | |||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1. | |||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1. | |||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1. | |||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [2] | |||
Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
DNA damage response signaling pathway | Activation | hsa04218 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Among the differentially expressed genes between the chemosensitive (5637) and chemoresistant (H-bc) bladder cancer cell lines, the expression level of the PSEN1 gene (presenilin 1), a key component of the Gamma-secretase, is negatively correlated with chemoresistance. A small interfering RNA mediated repression of the PSEN1 gene suppresses cell apoptosis and de-sensitizes 5637 cells, while overexpression of the presenilin 1 sensitizes H-bc cells to the drug-triggered cell death. As a direct target of microRNA-193a-3p that promotes the multi-chemoresistance of the bladder cancer cell, PSEN1 acts as an important executor for the microRNA-193a-3p's positive impact on the multi-chemoresistance of bladder cancer, probably via its activating effect on DNA damage response pathway. In addition to the mechanistic insights, the key players in this microRNA-193a-3p/PSEN1 axis are likely the diagnostic and/or therapeutic targets for an effective chemotherapy of bladder cancer. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [2] | |||
Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Sensitive Drug | Epirubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
DNA damage response signaling pathway | Activation | hsa04218 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Among the differentially expressed genes between the chemosensitive (5637) and chemoresistant (H-bc) bladder cancer cell lines, the expression level of the PSEN1 gene (presenilin 1), a key component of the Gamma-secretase, is negatively correlated with chemoresistance. A small interfering RNA mediated repression of the PSEN1 gene suppresses cell apoptosis and de-sensitizes 5637 cells, while overexpression of the presenilin 1 sensitizes H-bc cells to the drug-triggered cell death. As a direct target of microRNA-193a-3p that promotes the multi-chemoresistance of the bladder cancer cell, PSEN1 acts as an important executor for the microRNA-193a-3p's positive impact on the multi-chemoresistance of bladder cancer, probably via its activating effect on DNA damage response pathway. In addition to the mechanistic insights, the key players in this microRNA-193a-3p/PSEN1 axis are likely the diagnostic and/or therapeutic targets for an effective chemotherapy of bladder cancer. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. In contrast, the down-regulation of miR-193a-3p decreased the radioresistance and chemoresistance of ESCC cells. In addition, miR-193a-3p inducing DNA damage has also been demonstrated through measuring the level of gamma-H2AX associated with miR-193a-3p. Moreover, a small interfering RNA(siRNA)-induced repression of the PSEN1 gene had an effect similar to that of miR-193a-3p up-regulation. The above processes also inhibited oesophageal cancer cells apoptosis. These findings suggest that miR-193a-3p contributes to the radiation and chemotherapy resistance of oesophageal carcinoma by down-regulating PSEN1. | |||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1. | |||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [4] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
QGY-7703 cells | Liver | Homo sapiens (Human) | CVCL_6715 | |
SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
PLC cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
FOCUS cells | Liver | Homo sapiens (Human) | CVCL_7955 | |
YY-8103 cells | Liver | Homo sapiens (Human) | CVCL_WY40 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | SRSF2 preferentially up-regulates the proapoptotic splicing form of caspase 2 (CASP2L) and sensitizes HCC cells to 5-FU. miR-193a-3p Dictates Resistance of Hepatocellular Carcinoma to 5-Fluorouracil via Repression of SRSF2 Expression. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [5], [6], [7] | |||
Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
DNA damage repair signaling pathway | Inhibition | hsa03410 | ||
DNA damage response/Oxidative stress signaling pathway | Inhibition | hsa04218 | ||
Myc/Max signaling pathway | Inhibition | hsa04218 | ||
NF-kappaB signaling pathway | Inhibition | hsa04064 | ||
Notch signaling pathway | Activation | hsa04330 | ||
Oxidative stress signaling pathway | Regulation | hsa00190 | ||
Oxidative stress signaling pathway | Activation | hsa00190 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
BIU87 cells | Bladder | Homo sapiens (Human) | CVCL_6881 | |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR-193a-3p promotes the BCa multi-drug resistance phenotype via its repression of the lysyl oxidase-like 4 (LOXL4) gene, a newly identified direct target of miR-193a-3p. The LOXL4 protein is an important member of the lysyl oxidase (an extracellular copper-dependent amine oxidase) family that catalyzes the first step of the crosslinks between collagens and elastin during the biogenesis of connective tissue and is frequently deregulated in cancer. The Oxidative stress (OS) pathway is the predominant pathway affected by miR-193a-3p via its repression of LOXL4 expression. | |||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. In contrast, the down-regulation of miR-193a-3p decreased the radioresistance and chemoresistance of ESCC cells. In addition, miR-193a-3p inducing DNA damage has also been demonstrated through measuring the level of gamma-H2AX associated with miR-193a-3p. Moreover, a small interfering RNA(siRNA)-induced repression of the PSEN1 gene had an effect similar to that of miR-193a-3p up-regulation. The above processes also inhibited oesophageal cancer cells apoptosis. These findings suggest that miR-193a-3p contributes to the radiation and chemotherapy resistance of oesophageal carcinoma by down-regulating PSEN1. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [2] | |||
Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
DNA damage response signaling pathway | Activation | hsa04218 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Among the differentially expressed genes between the chemosensitive (5637) and chemoresistant (H-bc) bladder cancer cell lines, the expression level of the PSEN1 gene (presenilin 1), a key component of the Gamma-secretase, is negatively correlated with chemoresistance. A small interfering RNA mediated repression of the PSEN1 gene suppresses cell apoptosis and de-sensitizes 5637 cells, while overexpression of the presenilin 1 sensitizes H-bc cells to the drug-triggered cell death. As a direct target of microRNA-193a-3p that promotes the multi-chemoresistance of the bladder cancer cell, PSEN1 acts as an important executor for the microRNA-193a-3p's positive impact on the multi-chemoresistance of bladder cancer, probably via its activating effect on DNA damage response pathway. In addition to the mechanistic insights, the key players in this microRNA-193a-3p/PSEN1 axis are likely the diagnostic and/or therapeutic targets for an effective chemotherapy of bladder cancer. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [2] | |||
Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Sensitive Drug | Pirarubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
DNA damage response signaling pathway | Activation | hsa04218 | ||
In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
H-bc cells | Bladder | Homo sapiens (Human) | CVCL_BT00 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Among the differentially expressed genes between the chemosensitive (5637) and chemoresistant (H-bc) bladder cancer cell lines, the expression level of the PSEN1 gene (presenilin 1), a key component of the Gamma-secretase, is negatively correlated with chemoresistance. A small interfering RNA mediated repression of the PSEN1 gene suppresses cell apoptosis and de-sensitizes 5637 cells, while overexpression of the presenilin 1 sensitizes H-bc cells to the drug-triggered cell death. As a direct target of microRNA-193a-3p that promotes the multi-chemoresistance of the bladder cancer cell, PSEN1 acts as an important executor for the microRNA-193a-3p's positive impact on the multi-chemoresistance of bladder cancer, probably via its activating effect on DNA damage response pathway. In addition to the mechanistic insights, the key players in this microRNA-193a-3p/PSEN1 axis are likely the diagnostic and/or therapeutic targets for an effective chemotherapy of bladder cancer. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Vinorelbine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. In contrast, the down-regulation of miR-193a-3p decreased the radioresistance and chemoresistance of ESCC cells. In addition, miR-193a-3p inducing DNA damage has also been demonstrated through measuring the level of gamma-H2AX associated with miR-193a-3p. Moreover, a small interfering RNA(siRNA)-induced repression of the PSEN1 gene had an effect similar to that of miR-193a-3p up-regulation. The above processes also inhibited oesophageal cancer cells apoptosis. These findings suggest that miR-193a-3p contributes to the radiation and chemotherapy resistance of oesophageal carcinoma by down-regulating PSEN1. | |||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Vinorelbine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1. | |||
Disease Class: Esophageal cancer | [3] | |||
Resistant Disease | Esophageal cancer [ICD-11: 2B70.1] | |||
Resistant Drug | Vinorelbine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | KYSE150 cells | Esophagus | Homo sapiens (Human) | CVCL_1348 |
KYSE510 cells | Esophagus | Homo sapiens (Human) | CVCL_1354 | |
kYSE410 cells | Esophagus | Homo sapiens (Human) | CVCL_1352 | |
kYSE450 cells | Esophagus | Homo sapiens (Human) | CVCL_1353 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.