General Information of the Molecule (ID: Mol01616)
Name
hsa-miR-193a-3p ,Homo sapiens
Synonyms
microRNA 193a
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
AACUGGCCUACAAAGUCCCAGU
    Click to Show/Hide
Ensembl ID
ENSG00000207614
HGNC ID
HGNC:31563
Mature Accession
MIMAT0000459
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
Mitochondrial signaling pathway Inhibition hsa04217
In Vitro Model AGS cells Gastric Homo sapiens (Human) CVCL_0139
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
KATO-3 cells Gastric Homo sapiens (Human) CVCL_0371
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay; Flow cytometry assay
Mechanism Description SRSF2, a miR-193a-3p target gene, is downregulated and miR-193a-3p is upregulated, which induces the resistence to cisplatin.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [3]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
DNA damage response signaling pathway Activation hsa04218
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Among the differentially expressed genes between the chemosensitive (5637) and chemoresistant (H-bc) bladder cancer cell lines, the expression level of the PSEN1 gene (presenilin 1), a key component of the Gamma-secretase, is negatively correlated with chemoresistance. A small interfering RNA mediated repression of the PSEN1 gene suppresses cell apoptosis and de-sensitizes 5637 cells, while overexpression of the presenilin 1 sensitizes H-bc cells to the drug-triggered cell death. As a direct target of microRNA-193a-3p that promotes the multi-chemoresistance of the bladder cancer cell, PSEN1 acts as an important executor for the microRNA-193a-3p's positive impact on the multi-chemoresistance of bladder cancer, probably via its activating effect on DNA damage response pathway. In addition to the mechanistic insights, the key players in this microRNA-193a-3p/PSEN1 axis are likely the diagnostic and/or therapeutic targets for an effective chemotherapy of bladder cancer.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. In contrast, the down-regulation of miR-193a-3p decreased the radioresistance and chemoresistance of ESCC cells. In addition, miR-193a-3p inducing DNA damage has also been demonstrated through measuring the level of gamma-H2AX associated with miR-193a-3p. Moreover, a small interfering RNA(siRNA)-induced repression of the PSEN1 gene had an effect similar to that of miR-193a-3p up-regulation. The above processes also inhibited oesophageal cancer cells apoptosis. These findings suggest that miR-193a-3p contributes to the radiation and chemotherapy resistance of oesophageal carcinoma by down-regulating PSEN1.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [3]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
DNA damage response signaling pathway Activation hsa04218
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Among the differentially expressed genes between the chemosensitive (5637) and chemoresistant (H-bc) bladder cancer cell lines, the expression level of the PSEN1 gene (presenilin 1), a key component of the Gamma-secretase, is negatively correlated with chemoresistance. A small interfering RNA mediated repression of the PSEN1 gene suppresses cell apoptosis and de-sensitizes 5637 cells, while overexpression of the presenilin 1 sensitizes H-bc cells to the drug-triggered cell death. As a direct target of microRNA-193a-3p that promotes the multi-chemoresistance of the bladder cancer cell, PSEN1 acts as an important executor for the microRNA-193a-3p's positive impact on the multi-chemoresistance of bladder cancer, probably via its activating effect on DNA damage response pathway. In addition to the mechanistic insights, the key players in this microRNA-193a-3p/PSEN1 axis are likely the diagnostic and/or therapeutic targets for an effective chemotherapy of bladder cancer.
Epirubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [3]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Epirubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
DNA damage response signaling pathway Activation hsa04218
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Among the differentially expressed genes between the chemosensitive (5637) and chemoresistant (H-bc) bladder cancer cell lines, the expression level of the PSEN1 gene (presenilin 1), a key component of the Gamma-secretase, is negatively correlated with chemoresistance. A small interfering RNA mediated repression of the PSEN1 gene suppresses cell apoptosis and de-sensitizes 5637 cells, while overexpression of the presenilin 1 sensitizes H-bc cells to the drug-triggered cell death. As a direct target of microRNA-193a-3p that promotes the multi-chemoresistance of the bladder cancer cell, PSEN1 acts as an important executor for the microRNA-193a-3p's positive impact on the multi-chemoresistance of bladder cancer, probably via its activating effect on DNA damage response pathway. In addition to the mechanistic insights, the key players in this microRNA-193a-3p/PSEN1 axis are likely the diagnostic and/or therapeutic targets for an effective chemotherapy of bladder cancer.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. In contrast, the down-regulation of miR-193a-3p decreased the radioresistance and chemoresistance of ESCC cells. In addition, miR-193a-3p inducing DNA damage has also been demonstrated through measuring the level of gamma-H2AX associated with miR-193a-3p. Moreover, a small interfering RNA(siRNA)-induced repression of the PSEN1 gene had an effect similar to that of miR-193a-3p up-regulation. The above processes also inhibited oesophageal cancer cells apoptosis. These findings suggest that miR-193a-3p contributes to the radiation and chemotherapy resistance of oesophageal carcinoma by down-regulating PSEN1.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [5]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
QGY-7703 cells Liver Homo sapiens (Human) CVCL_6715
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
PLC cells Liver Homo sapiens (Human) CVCL_0485
FOCUS cells Liver Homo sapiens (Human) CVCL_7955
YY-8103 cells Liver Homo sapiens (Human) CVCL_WY40
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description SRSF2 preferentially up-regulates the proapoptotic splicing form of caspase 2 (CASP2L) and sensitizes HCC cells to 5-FU. miR-193a-3p Dictates Resistance of Hepatocellular Carcinoma to 5-Fluorouracil via Repression of SRSF2 Expression.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [6], [7], [8]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
DNA damage repair signaling pathway Inhibition hsa03410
DNA damage response/Oxidative stress signaling pathway Inhibition hsa04218
Myc/Max signaling pathway Inhibition hsa04218
NF-kappaB signaling pathway Inhibition hsa04064
Notch signaling pathway Activation hsa04330
Oxidative stress signaling pathway Regulation N.A.
Oxidative stress signaling pathway Activation hsa00190
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
T24 cells Bladder Homo sapiens (Human) CVCL_0554
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
BIU87 cells Bladder Homo sapiens (Human) CVCL_6881
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-193a-3p promotes the BCa multi-drug resistance phenotype via its repression of the lysyl oxidase-like 4 (LOXL4) gene, a newly identified direct target of miR-193a-3p. The LOXL4 protein is an important member of the lysyl oxidase (an extracellular copper-dependent amine oxidase) family that catalyzes the first step of the crosslinks between collagens and elastin during the biogenesis of connective tissue and is frequently deregulated in cancer. The Oxidative stress (OS) pathway is the predominant pathway affected by miR-193a-3p via its repression of LOXL4 expression.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. In contrast, the down-regulation of miR-193a-3p decreased the radioresistance and chemoresistance of ESCC cells. In addition, miR-193a-3p inducing DNA damage has also been demonstrated through measuring the level of gamma-H2AX associated with miR-193a-3p. Moreover, a small interfering RNA(siRNA)-induced repression of the PSEN1 gene had an effect similar to that of miR-193a-3p up-regulation. The above processes also inhibited oesophageal cancer cells apoptosis. These findings suggest that miR-193a-3p contributes to the radiation and chemotherapy resistance of oesophageal carcinoma by down-regulating PSEN1.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [3]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
DNA damage response signaling pathway Activation hsa04218
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Among the differentially expressed genes between the chemosensitive (5637) and chemoresistant (H-bc) bladder cancer cell lines, the expression level of the PSEN1 gene (presenilin 1), a key component of the Gamma-secretase, is negatively correlated with chemoresistance. A small interfering RNA mediated repression of the PSEN1 gene suppresses cell apoptosis and de-sensitizes 5637 cells, while overexpression of the presenilin 1 sensitizes H-bc cells to the drug-triggered cell death. As a direct target of microRNA-193a-3p that promotes the multi-chemoresistance of the bladder cancer cell, PSEN1 acts as an important executor for the microRNA-193a-3p's positive impact on the multi-chemoresistance of bladder cancer, probably via its activating effect on DNA damage response pathway. In addition to the mechanistic insights, the key players in this microRNA-193a-3p/PSEN1 axis are likely the diagnostic and/or therapeutic targets for an effective chemotherapy of bladder cancer.
Pirarubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0] [3]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Pirarubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
DNA damage response signaling pathway Activation hsa04218
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
H-bc cells Bladder Homo sapiens (Human) CVCL_BT00
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Among the differentially expressed genes between the chemosensitive (5637) and chemoresistant (H-bc) bladder cancer cell lines, the expression level of the PSEN1 gene (presenilin 1), a key component of the Gamma-secretase, is negatively correlated with chemoresistance. A small interfering RNA mediated repression of the PSEN1 gene suppresses cell apoptosis and de-sensitizes 5637 cells, while overexpression of the presenilin 1 sensitizes H-bc cells to the drug-triggered cell death. As a direct target of microRNA-193a-3p that promotes the multi-chemoresistance of the bladder cancer cell, PSEN1 acts as an important executor for the microRNA-193a-3p's positive impact on the multi-chemoresistance of bladder cancer, probably via its activating effect on DNA damage response pathway. In addition to the mechanistic insights, the key players in this microRNA-193a-3p/PSEN1 axis are likely the diagnostic and/or therapeutic targets for an effective chemotherapy of bladder cancer.
Vinorelbine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Vinorelbine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. In contrast, the down-regulation of miR-193a-3p decreased the radioresistance and chemoresistance of ESCC cells. In addition, miR-193a-3p inducing DNA damage has also been demonstrated through measuring the level of gamma-H2AX associated with miR-193a-3p. Moreover, a small interfering RNA(siRNA)-induced repression of the PSEN1 gene had an effect similar to that of miR-193a-3p up-regulation. The above processes also inhibited oesophageal cancer cells apoptosis. These findings suggest that miR-193a-3p contributes to the radiation and chemotherapy resistance of oesophageal carcinoma by down-regulating PSEN1.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Vinorelbine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1.
Disease Class: Esophageal cancer [ICD-11: 2B70.1] [4]
Resistant Disease Esophageal cancer [ICD-11: 2B70.1]
Resistant Drug Vinorelbine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model KYSE150 cells Esophagus Homo sapiens (Human) CVCL_1348
KYSE510 cells Esophagus Homo sapiens (Human) CVCL_1354
kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
kYSE450 cells Esophagus Homo sapiens (Human) CVCL_1353
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-193a-3p increased the radioresistance and chemoresistance of oesophageal squamous cell carcinoma (ESCC) cells. The regulation role of miR-193a-3p on multi-chemoresistance and radioresistance were mediated by PSEN1.
References
Ref 1 The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 2 Upregulated microRNA-193a-3p is responsible for cisplatin resistance in CD44(+) gastric cancer cells. Cancer Sci. 2019 Feb;110(2):662-673. doi: 10.1111/cas.13894. Epub 2018 Dec 26.
Ref 3 The miR-193a-3p regulated PSEN1 gene suppresses the multi-chemoresistance of bladder cancer. Biochim Biophys Acta. 2015 Mar;1852(3):520-8. doi: 10.1016/j.bbadis.2014.12.014. Epub 2014 Dec 24.
Ref 4 miR-193a-3p regulation of chemoradiation resistance in oesophageal cancer cells via the PSEN1 gene. Gene. 2016 Apr 1;579(2):139-45. doi: 10.1016/j.gene.2015.12.060. Epub 2015 Dec 29.
Ref 5 DNA methylation-regulated miR-193a-3p dictates resistance of hepatocellular carcinoma to 5-fluorouracil via repression of SRSF2 expression. J Biol Chem. 2012 Feb 17;287(8):5639-49. doi: 10.1074/jbc.M111.291229. Epub 2011 Nov 23.
Ref 6 The DNA methylation-regulated miR-193a-3p dictates the multi-chemoresistance of bladder cancer via repression of SRSF2/PLAU/HIC2 expression. Cell Death Dis. 2014 Sep 4;5(9):e1402. doi: 10.1038/cddis.2014.367.
Ref 7 miR-193a-3p regulates the multi-drug resistance of bladder cancer by targeting the LOXL4 gene and the oxidative stress pathway. Mol Cancer. 2014 Oct 14;13:234. doi: 10.1186/1476-4598-13-234.
Ref 8 MiR-193a-3p promotes the multi-chemoresistance of bladder cancer by targeting the HOXC9 gene. Cancer Lett. 2015 Feb 1;357(1):105-113. doi: 10.1016/j.canlet.2014.11.002. Epub 2014 Nov 11.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.