Molecule Information

General Information of the Molecule (ID: Mol01583)

• Name: hsa-miR-210-3p ,Homo sapiens
• Synonyms: microRNA 210
• Molecule Type: Mature miRNA
• Sequence: CUGUGCGUGUGACAGCGGCUGA
• Ensembl ID: ENSG00000199038
• HGNC ID: HGNC:31587
• Mature Accession: MIMAT0000267

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [1]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OE19 cells; Esophagus; Homo sapiens (Human); CVCL_1622
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR 210 3p regulates cell growth and affects cisplatin sensitivity in human ovarian cancer cells via targeting E2F3.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Breast cancer patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Mechanism Description: We performed the expression analysis of miR-210-3p in a retrospective cohort of breast cancer patients with a median follow-up of 76 months (n = 283). An association between higher levels of miR-210-3p and risk of disease progression (HR: 2.13, 95%CI: 1.33-3.39, P = 0.002) was found in the subgroup of patients treated with Epirubicin and Cyclophosphamide followed by Docetaxel.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [4]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• Experiment for Molecule Alteration: RT-qPCR
• Mechanism Description: By microarray and qRT-PCR, we observed significant downregulation of microRNA-210 in gemcitabine-resistant cells. The overexpression of microRNA-210 was toxic to gemcitabine-resistant cells and enhanced gemcitabine sensitivity. MicroRNA-210 overexpression induced caspase-3-mediated apoptosis, and inhibited colony formation. Computationally, ABCC5, a highly expressed gene in our array data, was identified as a potential target of microRNA-210 and the overexpression of ABCC5 in gemcitabine-resistant cells was confirmed by qRT-PCR. MicroRNA-210 overexpression reduced ABCC5 mRNA levels and inhibited a luciferase reporter expressing the ABCC5 3' UTR. The expression pattern of microRNA-210 and ABCC5 was mirrored in all of 5 pancreatic cancer cell lines used. Likewise, microRNA-210 transfection nearly totally inhibited tumor xenograft growth, proliferation and metastasis without obvious side effects in vivo.

References

• Ref 1: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 2: miR 210 3p regulates cell growth and affects cisplatin sensitivity in human ovarian cancer cells via targeting E2F3. Mol Med Rep. 2019 Jun;19(6):4946-4954. doi: 10.3892/mmr.2019.10129. Epub 2019 Apr 4.
• Ref 3: Alterations in p53 predict response to preoperative high dose chemotherapy in patients with gastric cancerMol Pathol. 2003 Oct;56(5):286-92. doi: 10.1136/mp.56.5.286.
• Ref 4: Characterization of LY3023414, a Novel PI3K/mTOR Dual Inhibitor Eliciting Transient Target Modulation to Impede Tumor GrowthMol Cancer Ther. 2016 Oct;15(10):2344-2356. doi: 10.1158/1535-7163.MCT-15-0996. Epub 2016 Jul 20.