Molecule Information
General Information of the Molecule (ID: Mol01571)
Name |
hsa-miR-139-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 139
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
UCUACAGUGCACGUGUCUCCAGU
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [1], [2] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
MAPK signaling pathway | Inhibition | hsa04010 | ||
c-Jun/BCL-xl signaling pathway | Regulation | hsa04210 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Recovery of miR-139-5p suppressed the expression of c-Jun and thus reversed cisplatin-resistance in ovarian cancer. And miR-139-5p overexpression combined with inactivation of the MAPk signaling pathway can reverse the cisplatin resistance of OC by suppressing RNF2. | |||
|
||||
Disease Class: Nasopharyngeal carcinoma | [3] | |||
Sensitive Disease | Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | HNE1 cells | Nasopharynx | Homo sapiens (Human) | CVCL_0308 |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The upregulation of miR-139-5p significantly increases DDP-induced apoptosis in NPC cells and modulates ZEB1 expression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [4] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Docetaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Notch signaling pathway | Regulation | hsa04330 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay; Transwell assay | |||
Mechanism Description | miR-139-5p inhibits the biological function of breast cancer cells by targeting Notch1 and mediates chemosensitivity to docetaxel. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [5] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell metastasis | Activation | hsa05205 | ||
Cell proliferation | Activation | hsa05200 | ||
miR139-5p/Notch1 signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Long non-coding RNA LINC00152 promotes cell proliferation, metastasis, and confers 5-FU resistance in colorectal cancer by inhibiting miR139-5p. LINC00152 could regulate the expression of NOTCH1 through sponging miR139-5p and inhibiting its activity from promoting CRC progression and development. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal carcinoma | [6] | |||
Sensitive Disease | Colorectal carcinoma [ICD-11: 2B91.3] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assay | |||
Mechanism Description | miR139-5p reverses CD44+/CD133+-associated multidrug resistance by downregulating NOTCH1 in colorectal carcinoma cells. | |||
Disease Class: Colorectal cancer | [7] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
IGF-1R/AKT/S6 signaling pathway | Inhibition | hsa05225 | ||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Transwell assay | |||
Mechanism Description | Ectopic expression of miR-139-5p sensitized CRC cells to 5-FU by increasing 5-FU-induced apoptosis. In addition, miR-139-5p inhibited the expression of the miR-139-5p target gene NOTCH-1 and its downstream molecules MRP-1 and BCL-2, two key MDR-associated genes. Furthermore, silencing NOTCH-1 expression promoted the chemotherapeutic effects of 5-FU, and up-regulation of NOTCH-1 abrogated miR-139-5p-mediated sensitization to 5-FU in LoVo and HCT-116 cells. | |||
|
||||
Disease Class: Colorectal cancer | [8] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | BCL2 signaling pathway | Regulation | hsa04210 | |
Cell apoptosis | Activation | hsa04210 | ||
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
LS174T cells | Colon | Homo sapiens (Human) | CVCL_1384 | |
COLO205 cells | Colon | Homo sapiens (Human) | CVCL_F402 | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Transwell assay | |||
Mechanism Description | BCL2 is a direct target of miR-139-5p in colorectal cancer cells and showed that the tumour suppressor activity of miR-139-5p is mediated by the modulation of BCL2 expression. BCL2 family proteins regulate and contribute to programmed cell death or apoptosis. The cell apoptosis results showed the induction of apoptotic cells contributed greatly to 5-Fu and OXA drug sensitivity, which was consistent with the multidrug resistance mechanisms. miR-139-5p is downregulated in colorectal cancer cells and tissues, and its inhibitory effects on cell migration, invasion, and drug sensitivity are mediated by the downregulation of its target BCL2. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal carcinoma | [6] | |||
Sensitive Disease | Colorectal carcinoma [ICD-11: 2B91.3] | |||
Sensitive Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assay | |||
Mechanism Description | miR139-5p reverses CD44+/CD133+-associated multidrug resistance by downregulating NOTCH1 in colorectal carcinoma cells. | |||
|
||||
Disease Class: Colorectal cancer | [8] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | BCL2 signaling pathway | Regulation | hsa04210 | |
Cell apoptosis | Activation | hsa04210 | ||
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
RkO cells | Colon | Homo sapiens (Human) | CVCL_0504 | |
HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
LS174T cells | Colon | Homo sapiens (Human) | CVCL_1384 | |
COLO205 cells | Colon | Homo sapiens (Human) | CVCL_F402 | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Transwell assay | |||
Mechanism Description | BCL2 is a direct target of miR-139-5p in colorectal cancer cells and showed that the tumour suppressor activity of miR-139-5p is mediated by the modulation of BCL2 expression. BCL2 family proteins regulate and contribute to programmed cell death or apoptosis. The cell apoptosis results showed the induction of apoptotic cells contributed greatly to 5-Fu and OXA drug sensitivity, which was consistent with the multidrug resistance mechanisms. miR-139-5p is downregulated in colorectal cancer cells and tissues, and its inhibitory effects on cell migration, invasion, and drug sensitivity are mediated by the downregulation of its target BCL2. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal carcinoma | [6] | |||
Sensitive Disease | Colorectal carcinoma [ICD-11: 2B91.3] | |||
Sensitive Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assay | |||
Mechanism Description | miR139-5p reverses CD44+/CD133+-associated multidrug resistance by downregulating NOTCH1 in colorectal carcinoma cells. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.