Molecule Information
General Information of the Molecule (ID: Mol01568)
| Name |
hsa-miR-129-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 129-1
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CUUUUUGCGGUCUGGGCUUGC
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay; DAPI staining assay | |||
| Mechanism Description | miR129-5p inhibits non-small cell lung cancer cell stemness and chemoresistance through targeting DLk1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7/ADM cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | There is a reciprocal regulation between miR129-5p and SOX4 via the SOX4/EZH2 complex mediated H3k27me3 modification in breast cancer cells. miR129-5p is an important miRNA modulating EMT and MDR in breast cancer cells. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8; Colony formation assay; wound healing; Transwell invasion; Flow cytometry assay | |||
| Mechanism Description | miR-129-5p suppresses Adriamycin resistance in breast cancer by directly targeting SOX2. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [4] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The over-expressed miR-129-5p reduced the chemo-resistance of SGC7901/VCR and SGC7901/ADR cells, while down-regulation of miR-129-5p had an opposite effect. Furthermore, three members of multi-drug resistance (MDR) related ABC transporters (ABCB1, ABCC5 and ABCG1) were found to be direct targets of miR-129-5p using bioinformatics analysis and report gene assays. The present study indicated that hyper-methylation of miR-129-5p CpG island might play important roles in the development of gastric cancer chemo-resistance by targeting MDR related ABC transporters and might be used as a potential therapeutic target in preventing the chemo-resistance of gastric cancer. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [5] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Epirubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell migration | Activation | hsa04670 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 toxicity assay | |||
| Mechanism Description | NONHSAT101069 was upregulated in BC tissues and promoted epirubicin resistance, migration and invasion of BC cells via regulation of NONHSAT101069/miR-129-5p/Twist1 axis, highlighting its potential as an oncogene and a therapeutic biomarker for BC. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [6] | |||
| Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | SW780 cells | Bladder | Homo sapiens (Human) | CVCL_1728 |
| UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-129-5p inhibits gemcitabine resistance and promotes cell apoptosis of bladder cancer cells by downregulating Wnt5a. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7/ADM cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | There is a reciprocal regulation between miR129-5p and SOX4 via the SOX4/EZH2 complex mediated H3k27me3 modification in breast cancer cells. miR129-5p is an important miRNA modulating EMT and MDR in breast cancer cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [7] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Trastuzumab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | PI3K/AKT/mTOR signaling pathway | Inhibition | hsa04151 | |
| In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
| JIMT-1 cells | Breast | Homo sapiens (Human) | CVCL_2077 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR129-5p might inhibit trastuzumab resistance through downregulating rpS6 in Her-2-positive breast cancer cells, thus inactivating the PI3k/Akt/mTOR/ rpS6 pathway. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7/ADM cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | There is a reciprocal regulation between miR129-5p and SOX4 via the SOX4/EZH2 complex mediated H3k27me3 modification in breast cancer cells. miR129-5p is an important miRNA modulating EMT and MDR in breast cancer cells. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [4] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The over-expressed miR-129-5p reduced the chemo-resistance of SGC7901/VCR and SGC7901/ADR cells, while down-regulation of miR-129-5p had an opposite effect. Furthermore, three members of multi-drug resistance (MDR) related ABC transporters (ABCB1, ABCC5 and ABCG1) were found to be direct targets of miR-129-5p using bioinformatics analysis and report gene assays. The present study indicated that hyper-methylation of miR-129-5p CpG island might play important roles in the development of gastric cancer chemo-resistance by targeting MDR related ABC transporters and might be used as a potential therapeutic target in preventing the chemo-resistance of gastric cancer. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
