General Information of the Molecule (ID: Mol01566)
Name
hsa-miR-199a-5p ,Homo sapiens
Synonyms
microRNA 199a-1
    Click to Show/Hide
Molecule Type
Mature miRNA
Sequence
CCCAGUGUUCAGACUACCUGUUC
    Click to Show/Hide
Ensembl ID
ENSG00000207752
HGNC ID
HGNC:31571
Mature Accession
MIMAT0000231
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cetuximab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Cetuximab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT signaling pathway Inhibition hsa04151
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model GEO CR cells Colon Homo sapiens (Human) CVCL_0271
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description The ability of miR-199a-5p and miR-375 to target PHLPP1 (PH domain and leucine-rich repeat protein phosphatase 1), a tumor suppressor that negatively regulates the AkT pathway, accounts, at least in part, for their drug-resistance activity. Indeed, restoration of PHLPP1 increases sensitivity of the GEO cells to CTX and reverts the resistance-promoting effect of miR-199a-5p and miR-375.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [2]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-199a-5p levels were significantly decreased in HCC patients treated with cisplatin-based chemotherapy. Downregulated miR-199a-5p enhanced autophagy activation by targeting ATG7. Cisplatin-induced downregulation of miR-199a-5p increases cell proliferation by activating autophagy.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [3]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR199a-5p directly targeted Beclin1 and negatively mediated Beclin1 expression at a post-transcriptional level, microRNA-199a-5p inhibits cisplatin-induced drug resistance via inhibition of autophagy in osteosarcoma cells.
Imatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [4]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Sensitive Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
Wnt2-mediated Beta-catenin signaling pathway Inhibition hsa04310
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Ku812 cells Bone marrow Homo sapiens (Human) CVCL_0379
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description microRNA-199a/b-5p enhance imatinib efficacy via repressing WNT2 signaling-mediated protective autophagy in imatinib-resistant chronic myeloid leukemia cells.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [5]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR; Northern blotting analysis
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-199a-5p over-expression is able to inhibit CRC cell proliferation and reverse tumor cell drug resistance in vitro and in vivo, partly through suppressing the expression of CAC1 protein at the post-transcriptional level in CRC.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Trichostatin A
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder carcinoma [6]
Resistant Disease Bladder carcinoma [ICD-11: 2C94.1]
Resistant Drug Trichostatin A
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model J82 cells Bladder Homo sapiens (Human) CVCL_0359
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
Disease Class: Adult acute myeloid leukemia [6]
Resistant Disease Adult acute myeloid leukemia [ICD-11: 2A60.1]
Resistant Drug Trichostatin A
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
Disease Class: Colon carcinoma [6]
Resistant Disease Colon carcinoma [ICD-11: 2B90.2]
Resistant Drug Trichostatin A
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
Disease Class: Gastric cancer [6]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Trichostatin A
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
References
Ref 1 MiR-199a-5p and miR-375 affect colon cancer cell sensitivity to cetuximab by targeting PHLPP1. Expert Opin Ther Targets. 2015;19(8):1017-26. doi: 10.1517/14728222.2015.1057569. Epub 2015 Jun 24.
Ref 2 Cisplatin-induced downregulation of miR-199a-5p increases drug resistance by activating autophagy in HCC cell. Biochem Biophys Res Commun. 2012 Jul 13;423(4):826-31. doi: 10.1016/j.bbrc.2012.06.048. Epub 2012 Jun 16.
Ref 3 MicroRNA-199a-5p inhibits cisplatin-induced drug resistance via inhibition of autophagy in osteosarcoma cells. Oncol Lett. 2016 Nov;12(5):4203-4208. doi: 10.3892/ol.2016.5172. Epub 2016 Sep 22.
Ref 4 microRNA-199a/b-5p enhance imatinib efficacy via repressing WNT2 signaling-mediated protective autophagy in imatinib-resistant chronic myeloid leukemia cells. Chem Biol Interact. 2018 Aug 1;291:144-151. doi: 10.1016/j.cbi.2018.06.006. Epub 2018 Jun 8.
Ref 5 The deoxycholic acid targets miRNA-dependent CAC1 gene expression in multidrug resistance of human colorectal cancer. Int J Biochem Cell Biol. 2012 Dec;44(12):2321-32. doi: 10.1016/j.biocel.2012.08.006. Epub 2012 Aug 10.
Ref 6 miR-30d, miR-181a and miR-199a-5p cooperatively suppress the endoplasmic reticulum chaperone and signaling regulator GRP78 in cancer. Oncogene. 2013 Sep 26;32(39):4694-701. doi: 10.1038/onc.2012.483. Epub 2012 Oct 22.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.