Molecule Information
General Information of the Molecule (ID: Mol01545)
Name |
hsa-miR-17-5p
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 17
Click to Show/Hide
|
||||
Molecule Type |
Mature miRNA
|
||||
Sequence |
CAAAGUGCUUACAGUGCAGGUAG
Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Mature Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prolactin-secreting adenoma | [1] | |||
Resistant Disease | Prolactin-secreting adenoma [ICD-11: 2F37.Y] | |||
Resistant Drug | Bromocriptine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
In Vitro Model | C4-2 cells | Prostate | Homo sapiens (Human) | CVCL_4782 |
Experiment for Molecule Alteration |
Solexa sequencing assay; qRT-PCR | |||
Experiment for Drug Resistance |
CCK-8 assay | |||
Mechanism Description | Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prolactin-secreting adenoma | [1] | |||
Resistant Disease | Prolactin-secreting adenoma [ICD-11: 2F37.Y] | |||
Resistant Drug | Cabergoline | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
In Vitro Model | C4-2 cells | Prostate | Homo sapiens (Human) | CVCL_4782 |
Experiment for Molecule Alteration |
Solexa sequencing assay; qRT-PCR | |||
Experiment for Drug Resistance |
CCK-8 assay | |||
Mechanism Description | Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Down-regulation of miR-17-5p reverses drug resistance of gastric cancer cells and increases p21 expression in SGC7901/DDP cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [3] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Erlotinib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR17-5p down-regulation contributes to erlotinib resistance in non-small cell lung cancer cells, miR17-5p could inhibit the mRNA and protein levels of EZH1. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [4] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
PTEN/AKT/PI3K signaling pathway | Activation | hsa05235 | ||
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
COLO205 cells | Colon | Homo sapiens (Human) | CVCL_F402 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [5] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Gefitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
A549/GR cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis | |||
Mechanism Description | Increased miR17-5p and miR92a expression and decreased let-7b expression can significantly induce proliferation and inhibit apoptosis of lung cancer cells, while reducing lung cancer cell sensitivity to Gefitinib. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [4] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Irinotecan | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
PTEN/AKT/PI3K signaling pathway | Activation | hsa05235 | ||
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
COLO205 cells | Colon | Homo sapiens (Human) | CVCL_F402 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [4] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
PTEN/AKT/PI3K signaling pathway | Activation | hsa05235 | ||
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
COLO205 cells | Colon | Homo sapiens (Human) | CVCL_F402 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [6] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
PTEN/AKT signaling pathway | Regulation | hsa05235 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | microRNA-17-5p induces drug resistance and invasion of ovarian carcinoma cells by targeting PTEN signaling. | |||
Disease Class: Lung cancer | [7] | |||
Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Trypan blue exclusion assay; Flow cytometry assay | |||
Mechanism Description | Overexpression of miR-17-5p sensitized paclitaxel resistant lung cancer cells to paclitaxel induced apoptotic cell death. miR-17-5p directly binds to the 3'-UTR of beclin 1 gene, one of the most important autophagy modulator. Overexpression of miR-17-5p into paclitaxel resistant lung cancer cells reduced beclin1 expression and a concordant decease in cellular autophagy. Paclitaxel resistance of lung cancer is associated with downregulation of miR-17-5p expression which might cause upregulation of BECN1 expression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [8] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | STAT3/p53 pathway | Inhibition | hsa05212 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
TUNEL assaay; Sulphorhodamine B assay | |||
Mechanism Description | miR17-5p promoted apoptosis by increasing p53 expression, which was inhibited by STAT3, miR17-5p inhibits STAT3 and increases p53 expression to promote apoptosis in breast cancer cells. miR17-5p directly targets STAT3 and induces apoptosis in breast cancer cells by inhibiting the STAT3/p53 pathway. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.