Molecule Information

General Information of the Molecule (ID: Mol01545)

• Name: hsa-miR-17-5p ,Homo sapiens
• Synonyms: microRNA 17
• Molecule Type: Mature miRNA
• Sequence: CAAAGUGCUUACAGUGCAGGUAG
• Ensembl ID: ENSG00000284536
• HGNC ID: HGNC:31547
• Mature Accession: MIMAT0000070

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 9 drug(s) in total

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [1]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: C4-2 cells; Prostate; Homo sapiens (Human); CVCL_4782
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: CCK-8 assay
• Mechanism Description: Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment.

Cabergoline

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [1]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Cabergoline
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: C4-2 cells; Prostate; Homo sapiens (Human); CVCL_4782
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: CCK-8 assay
• Mechanism Description: Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment.

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Down-regulation of miR-17-5p reverses drug resistance of gastric cancer cells and increases p21 expression in SGC7901/DDP cells.

Erlotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [3]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Erlotinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR17-5p down-regulation contributes to erlotinib resistance in non-small cell lung cancer cells, miR17-5p could inhibit the mRNA and protein levels of EZH1.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [4]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT/PI3K signaling pathway; Activation; hsa05235
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: COLO205 cells; Colon; Homo sapiens (Human); CVCL_F402
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance.

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [5]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549/GR cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometric analysis
• Mechanism Description: Increased miR17-5p and miR92a expression and decreased let-7b expression can significantly induce proliferation and inhibit apoptosis of lung cancer cells, while reducing lung cancer cell sensitivity to Gefitinib.

Irinotecan

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [4]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Irinotecan
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT/PI3K signaling pathway; Activation; hsa05235
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: COLO205 cells; Colon; Homo sapiens (Human); CVCL_F402
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [4]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT/PI3K signaling pathway; Activation; hsa05235
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: COLO205 cells; Colon; Homo sapiens (Human); CVCL_F402
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [6]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT signaling pathway; Regulation; hsa05235
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: microRNA-17-5p induces drug resistance and invasion of ovarian carcinoma cells by targeting PTEN signaling.

Disease Class: Lung cancer [7]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Trypan blue exclusion assay; Flow cytometry assay
• Mechanism Description: Overexpression of miR-17-5p sensitized paclitaxel resistant lung cancer cells to paclitaxel induced apoptotic cell death. miR-17-5p directly binds to the 3'-UTR of beclin 1 gene, one of the most important autophagy modulator. Overexpression of miR-17-5p into paclitaxel resistant lung cancer cells reduced beclin1 expression and a concordant decease in cellular autophagy. Paclitaxel resistance of lung cancer is associated with downregulation of miR-17-5p expression which might cause upregulation of BECN1 expression.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [8]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: STAT3/p53 pathway; Inhibition; hsa05212
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL assaay; Sulphorhodamine B assay
• Mechanism Description: miR17-5p promoted apoptosis by increasing p53 expression, which was inhibited by STAT3, miR17-5p inhibits STAT3 and increases p53 expression to promote apoptosis in breast cancer cells. miR17-5p directly targets STAT3 and induces apoptosis in breast cancer cells by inhibiting the STAT3/p53 pathway.

References

• Ref 1: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 2: Downregulation of microRNA-17-5p inhibits drug resistance of gastric cancer cells partially through targeting p21. Oncol Lett. 2018 Apr;15(4):4585-4591. doi: 10.3892/ol.2018.7822. Epub 2018 Jan 19.
• Ref 3: miR-17-5p down-regulation contributes to erlotinib resistance in non-small cell lung cancer cells. J Drug Target. 2017 Feb;25(2):125-131. doi: 10.1080/1061186X.2016.1207647. Epub 2016 Sep 16.
• Ref 4: MicroRNA-17-5p promotes chemotherapeutic drug resistance and tumour metastasis of colorectal cancer by repressing PTEN expression. Oncotarget. 2014 May 30;5(10):2974-87. doi: 10.18632/oncotarget.1614.
• Ref 5: The relationship between miR-17-5p, miR-92a, and let-7b expression with non-small cell lung cancer targeted drug resistance. J BUON. 2017 Mar-Apr;22(2):454-461.
• Ref 6: MicroRNA-17-5p induces drug resistance and invasion of ovarian carcinoma cells by targeting PTEN signaling. J Biol Res (Thessalon). 2015 Oct 22;22:12. doi: 10.1186/s40709-015-0035-2. eCollection 2015 Dec.
• Ref 7: miR-17-5p downregulation contributes to paclitaxel resistance of lung cancer cells through altering beclin1 expression. PLoS One. 2014 Apr 22;9(4):e95716. doi: 10.1371/journal.pone.0095716. eCollection 2014.
• Ref 8: STAT3 is required for MiR-17-5p-mediated sensitization to chemotherapy-induced apoptosis in breast cancer cells. Oncotarget. 2017 Feb 28;8(9):15763-15774. doi: 10.18632/oncotarget.15000.