Molecule Information
General Information of the Molecule (ID: Mol01545)
| Name |
hsa-miR-17-5p
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 17
Click to Show/Hide
|
||||
| Molecule Type |
Mature miRNA
|
||||
| Sequence |
CAAAGUGCUUACAGUGCAGGUAG
Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Mature Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] | [1] | |||
| Resistant Disease | Prolactin-secreting adenoma [ICD-11: 2F37.Y] | |||
| Resistant Drug | Bromocriptine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | C4-2 cells | Prostate | Homo sapiens (Human) | CVCL_4782 |
| Experiment for Molecule Alteration |
Solexa sequencing assay; qRT-PCR | |||
| Experiment for Drug Resistance |
CCK-8 assay | |||
| Mechanism Description | Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] | [1] | |||
| Resistant Disease | Prolactin-secreting adenoma [ICD-11: 2F37.Y] | |||
| Resistant Drug | Cabergoline | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | C4-2 cells | Prostate | Homo sapiens (Human) | CVCL_4782 |
| Experiment for Molecule Alteration |
Solexa sequencing assay; qRT-PCR | |||
| Experiment for Drug Resistance |
CCK-8 assay | |||
| Mechanism Description | Overexpression of mir-93 increased resistance to bromocriptine and cabergoline treatment. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Down-regulation of miR-17-5p reverses drug resistance of gastric cancer cells and increases p21 expression in SGC7901/DDP cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [3] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Erlotinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR17-5p down-regulation contributes to erlotinib resistance in non-small cell lung cancer cells, miR17-5p could inhibit the mRNA and protein levels of EZH1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [4] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| PTEN/AKT/PI3K signaling pathway | Activation | hsa05235 | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| COLO205 cells | Colon | Homo sapiens (Human) | CVCL_F402 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [5] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Gefitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| A549/GR cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis | |||
| Mechanism Description | Increased miR17-5p and miR92a expression and decreased let-7b expression can significantly induce proliferation and inhibit apoptosis of lung cancer cells, while reducing lung cancer cell sensitivity to Gefitinib. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [4] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Irinotecan | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| PTEN/AKT/PI3K signaling pathway | Activation | hsa05235 | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| COLO205 cells | Colon | Homo sapiens (Human) | CVCL_F402 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [4] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| PTEN/AKT/PI3K signaling pathway | Activation | hsa05235 | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| COLO205 cells | Colon | Homo sapiens (Human) | CVCL_F402 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | The expression level of miRNA-17-5p was found increased in chemoresistant patients. Significantly higher expression levels of miR-17-5p were found in CRC patients with distant metastases and higher clinical stages. kaplan-Meier analysis showed that CRC patients with higher levels of miR-17-5p had reduced survival, especially in patients who had previously received chemotherapy. Overexpression of miR-17-5p promoted COLO205 cell invasiveness. PTEN was a target of miR-17-5p in the colon cancer cells, and their context-specific interactions were responsible for multiple drug-resistance. Chemotherapy was found to increase the expression levels of miR-17-5p, which further repressed PTEN levels, contributing to the development of chemo-resistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [6] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| PTEN/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | microRNA-17-5p induces drug resistance and invasion of ovarian carcinoma cells by targeting PTEN signaling. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [7] | |||
| Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Trypan blue exclusion assay; Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-17-5p sensitized paclitaxel resistant lung cancer cells to paclitaxel induced apoptotic cell death. miR-17-5p directly binds to the 3'-UTR of beclin 1 gene, one of the most important autophagy modulator. Overexpression of miR-17-5p into paclitaxel resistant lung cancer cells reduced beclin1 expression and a concordant decease in cellular autophagy. Paclitaxel resistance of lung cancer is associated with downregulation of miR-17-5p expression which might cause upregulation of BECN1 expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [8] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | STAT3/p53 pathway | Inhibition | hsa05212 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
TUNEL assaay; Sulphorhodamine B assay | |||
| Mechanism Description | miR17-5p promoted apoptosis by increasing p53 expression, which was inhibited by STAT3, miR17-5p inhibits STAT3 and increases p53 expression to promote apoptosis in breast cancer cells. miR17-5p directly targets STAT3 and induces apoptosis in breast cancer cells by inhibiting the STAT3/p53 pathway. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
