Molecule Information
General Information of the Molecule (ID: Mol01526)
Name |
hsa-mir-629
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 629
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR629
|
||||
Gene ID | |||||
Location |
chr15:70079372-70079468[-]
|
||||
Sequence |
UCCCUUUCCCAGGGGAGGGGCUGGGUUUACGUUGGGAGAACUUUUACGGUGAACCAGGAG
GUUCUCCCAACGUAAGCCCAGCCCCUCCCCUCUGCCU Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Investigative Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Cervical cancer | [1] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Benzenemethanol | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 |
Caski cells | Uterus | Homo sapiens (Human) | CVCL_1100 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Annexin V/propidium iodide (PI) assay; Caspase 3/7 assay | |||
Mechanism Description | Suppression of microRNA-629 enhances sensitivity of cervical cancer cells to 1'S-1'-acetoxychavicol acetate via up-regulating RSU1. ACA downregulates miR629 expression and suppression of miR629 enhances sensitivity toward ACA, however, overexpression of miR629 did not cause significant differences in sensitivity toward ACA. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.