Molecule Information
General Information of the Molecule (ID: Mol01526)
| Name |
hsa-mir-629
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 629
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR629
|
||||
| Gene ID | |||||
| Location |
chr15:70079372-70079468[-]
|
||||
| Sequence |
UCCCUUUCCCAGGGGAGGGGCUGGGUUUACGUUGGGAGAACUUUUACGGUGAACCAGGAG
GUUCUCCCAACGUAAGCCCAGCCCCUCCCCUCUGCCU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Investigative Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [1] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Benzenemethanol | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 |
| Caski cells | Uterus | Homo sapiens (Human) | CVCL_1100 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Annexin V/propidium iodide (PI) assay; Caspase 3/7 assay | |||
| Mechanism Description | Suppression of microRNA-629 enhances sensitivity of cervical cancer cells to 1'S-1'-acetoxychavicol acetate via up-regulating RSU1. ACA downregulates miR629 expression and suppression of miR629 enhances sensitivity toward ACA, however, overexpression of miR629 did not cause significant differences in sensitivity toward ACA. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
