Molecule Information

General Information of the Molecule (ID: Mol01526)

• Name: hsa-mir-629 ,Homo sapiens
• Synonyms: microRNA 629
• Molecule Type: Precursor miRNA
• Gene Name: MIR629
• Gene ID: 693214
• Location: chr15:70079372-70079468[-]
• Sequence:
  UCCCUUUCCCAGGGGAGGGGCUGGGUUUACGUUGGGAGAACUUUUACGGUGAACCAGGAG
  GUUCUCCCAACGUAAGCCCAGCCCCUCCCCUCUGCCU
• Ensembl ID: ENSG00000207965
• HGNC ID: HGNC:32885
• Precursor Accession: MI0003643

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [4]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [2]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR; RT-PCR
• Experiment for Drug Resistance: Flow cytometry; MTT assay
• Mechanism Description: Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).

Investigative Drug(s) 1 drug(s) in total

Benzenemethanol

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [5]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Benzenemethanol
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• In Vitro Model: Caski cells; Uterus; Homo sapiens (Human); CVCL_1100
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Annexin V/propidium iodide (PI) assay; Caspase 3/7 assay
• Mechanism Description: Suppression of microRNA-629 enhances sensitivity of cervical cancer cells to 1'S-1'-acetoxychavicol acetate via up-regulating RSU1. ACA downregulates miR629 expression and suppression of miR629 enhances sensitivity toward ACA, however, overexpression of miR629 did not cause significant differences in sensitivity toward ACA.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
• Ref 3: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 4: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 5: Suppression of microRNA-629 enhances sensitivity of cervical cancer cells to 1'S-1'-acetoxychavicol acetate via regulating RSU1. Onco Targets Ther. 2017 Mar 20;10:1695-1705. doi: 10.2147/OTT.S117492. eCollection 2017.