Molecule Information

General Information of the Molecule (ID: Mol01510)

• Name: hsa-mir-181d ,Homo sapiens
• Synonyms: microRNA 181d
• Molecule Type: Precursor miRNA
• Gene Name: MIR181D
• Gene ID: 574457
• Location: chr19:13874875-13875011[+]
• Sequence:
  GUCCCCUCCCCUAGGCCACAGCCGAGGUCACAAUCAACAUUCAUUGUUGUCGGUGGGUUG
  UGAGGACUGAGGCCAGACCCACCGGGGGAUGAAUGUCACUGUGGCUGGGCCAGACACGGC
  UUAAGGGGAAUGGGGAC
• Ensembl ID: ENSG00000207585
• HGNC ID: HGNC:32089
• Precursor Accession: MI0003139

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [ICD-11: 2A00.02] [2]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Ras-associated protein 1 (Rap1), a growth regulatory protein, belongs to a member of RAS-like small GTP-binding protein superfamily. Rap1 regulates several basic cellular functions: migration, adhesion and growth. TMZ can inhibit the Rap1B expression to exert its cell killing by upregulating miR-181a/b/c/d subunits; conversely, each miR-181a/b/c/d subunit enhanced the chemosensitivity of TMZ in glioblastoma.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Disease- and Tissue-specific Abundances of This Molecule

ICD Disease Classification 02

Brain cancer [ICD-11: 2A00]

Differential expression of molecule in resistant diseases

• The Studied Tissue: Brain
• The Specified Disease: Brain lower grade glioma
• The Expression Level of Disease Section Compare with the Healthy Individual Tissue: p-value: 1.58E-01; Fold-change: 7.01E-02
• The Studied Tissue: Brain
• The Specified Disease: Glioblastoma multiforme
• The Expression Level of Disease Section Compare with the Healthy Individual Tissue: p-value: 2.98E-02; Fold-change: 1.46E-01

References

• Ref 1: Differential miRNA expression profiles in hepatocellular carcinoma cells and drug-resistant sublines. Oncol Rep. 2013 Feb;29(2):555-62. doi: 10.3892/or.2012.2155. Epub 2012 Nov 28.
• Ref 2: miR-181 subunits enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeleton remodeling in glioblastoma cells. Med Oncol. 2014 Apr;31(4):892. doi: 10.1007/s12032-014-0892-9. Epub 2014 Feb 27.