Molecule Information
General Information of the Molecule (ID: Mol01507)
Name |
hsa-mir-495
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 495
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR495
|
||||
Gene ID | |||||
Location |
chr14:101033755-101033836[+]
|
||||
Sequence |
UGGUACCUGAAAAGAAGUUGCCCAUGUUAUUUUCGCUUUAUAUGUGACGAAACAAACAUG
GUGCACUUCUUUUUCGGUAUCA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung small cell carcinoma | [1] | |||
Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | NCI-H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 |
NCI-H69 cells | Lung | Homo sapiens (Human) | CVCL_1579 | |
H69/AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Cell scratch-wound healing assay; Flow cytometry assay | |||
Mechanism Description | miR495 promotes the chemoresistance of SCLC through the epithelial-mesenchymal transition via Etk/BMX. Ectopic expression of Etk/BMX obviously rescued the miR495 elevation elevation-induced inhibition of drug resistance. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
mTOR signaling pathway | Inhibition | hsa04150 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung small cell carcinoma | [1] | |||
Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | NCI-H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 |
NCI-H69 cells | Lung | Homo sapiens (Human) | CVCL_1579 | |
H69/AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Cell scratch-wound healing assay; Flow cytometry assay | |||
Mechanism Description | miR495 promotes the chemoresistance of SCLC through the epithelial-mesenchymal transition via Etk/BMX. Ectopic expression of Etk/BMX obviously rescued the miR495 elevation elevation-induced inhibition of drug resistance. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Solid tumour/cancer | [3] | |||
Sensitive Disease | Solid tumour/cancer [ICD-11: 2A00-2F9Z] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
A2780C cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
A2780DX5 cells | Ovary | Homo sapiens (Human) | CVCL_4T98 | |
SGC7901R cells | Uterus | Homo sapiens (Human) | CVCL_0520 | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
Annexin-V-FITC apoptosis detection assay; Caspase-3 activity assay; MTT assay; Trypan blue exclusion assay | |||
Mechanism Description | miR-495 sensitizes MDR cancer cells to the combination of doxorubicin and taxol by inhibiting MDR1 expression, miR-495 was predicted to target ABCB1, which encodes protein MDR1. | |||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
mTOR signaling pathway | Inhibition | hsa04150 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung small cell carcinoma | [1] | |||
Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
Resistant Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | NCI-H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 |
NCI-H69 cells | Lung | Homo sapiens (Human) | CVCL_1579 | |
H69/AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Cell scratch-wound healing assay; Flow cytometry assay | |||
Mechanism Description | miR495 promotes the chemoresistance of SCLC through the epithelial-mesenchymal transition via Etk/BMX. Ectopic expression of Etk/BMX obviously rescued the miR495 elevation elevation-induced inhibition of drug resistance. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
mTOR signaling pathway | Inhibition | hsa04150 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Mitomycin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
mTOR signaling pathway | Inhibition | hsa04150 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Solid tumour/cancer | [3] | |||
Sensitive Disease | Solid tumour/cancer [ICD-11: 2A00-2F9Z] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
A2780C cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
A2780DX5 cells | Ovary | Homo sapiens (Human) | CVCL_4T98 | |
SGC7901R cells | Uterus | Homo sapiens (Human) | CVCL_0520 | |
In Vivo Model | Mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
Annexin-V-FITC apoptosis detection assay; Caspase-3 activity assay; MTT assay; Trypan blue exclusion assay | |||
Mechanism Description | miR-495 sensitizes MDR cancer cells to the combination of doxorubicin and taxol by inhibiting MDR1 expression, miR-495 was predicted to target ABCB1, which encodes protein MDR1. |
Investigative Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [4] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Platinum | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | ATP7A is a direct target gene of miR-495 and can be negatively regulated by miR-495. The inhibition of miR-495 reduced the cell sensitivity to CDDP in A549 and H1299 cells; miR-495 regulates the cell response to platinum drug resistance by modulation of ATP7A expression. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.