Molecule Information
General Information of the Molecule (ID: Mol01507)
| Name |
hsa-mir-495
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 495
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR495
|
||||
| Gene ID | |||||
| Location |
chr14:101033755-101033836[+]
|
||||
| Sequence |
UGGUACCUGAAAAGAAGUUGCCCAUGUUAUUUUCGCUUUAUAUGUGACGAAACAAACAUG
GUGCACUUCUUUUUCGGUAUCA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [1] | |||
| Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | NCI-H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 |
| NCI-H69 cells | Lung | Homo sapiens (Human) | CVCL_1579 | |
| H69/AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Cell scratch-wound healing assay; Flow cytometry assay | |||
| Mechanism Description | miR495 promotes the chemoresistance of SCLC through the epithelial-mesenchymal transition via Etk/BMX. Ectopic expression of Etk/BMX obviously rescued the miR495 elevation elevation-induced inhibition of drug resistance. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| mTOR signaling pathway | Inhibition | hsa04150 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [1] | |||
| Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | NCI-H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 |
| NCI-H69 cells | Lung | Homo sapiens (Human) | CVCL_1579 | |
| H69/AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Cell scratch-wound healing assay; Flow cytometry assay | |||
| Mechanism Description | miR495 promotes the chemoresistance of SCLC through the epithelial-mesenchymal transition via Etk/BMX. Ectopic expression of Etk/BMX obviously rescued the miR495 elevation elevation-induced inhibition of drug resistance. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Solid tumour/cancer [ICD-11: 2A00-2F9Z] | [3] | |||
| Sensitive Disease | Solid tumour/cancer [ICD-11: 2A00-2F9Z] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| A2780C cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| A2780DX5 cells | Ovary | Homo sapiens (Human) | CVCL_4T98 | |
| SGC7901R cells | Uterus | Homo sapiens (Human) | CVCL_0520 | |
| In Vivo Model | Mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Annexin-V-FITC apoptosis detection assay; Caspase-3 activity assay; MTT assay; Trypan blue exclusion assay | |||
| Mechanism Description | miR-495 sensitizes MDR cancer cells to the combination of doxorubicin and taxol by inhibiting MDR1 expression, miR-495 was predicted to target ABCB1, which encodes protein MDR1. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| mTOR signaling pathway | Inhibition | hsa04150 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] | [1] | |||
| Resistant Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
| Resistant Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | NCI-H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 |
| NCI-H69 cells | Lung | Homo sapiens (Human) | CVCL_1579 | |
| H69/AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Cell scratch-wound healing assay; Flow cytometry assay | |||
| Mechanism Description | miR495 promotes the chemoresistance of SCLC through the epithelial-mesenchymal transition via Etk/BMX. Ectopic expression of Etk/BMX obviously rescued the miR495 elevation elevation-induced inhibition of drug resistance. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| mTOR signaling pathway | Inhibition | hsa04150 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Mitomycin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| mTOR signaling pathway | Inhibition | hsa04150 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | The miR-495 exerts promotive effects on GC chemosensitivity via inactivation of the mTOR signaling pathway by suppressing ERBB2. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Solid tumour/cancer [ICD-11: 2A00-2F9Z] | [3] | |||
| Sensitive Disease | Solid tumour/cancer [ICD-11: 2A00-2F9Z] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| A2780C cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| A2780DX5 cells | Ovary | Homo sapiens (Human) | CVCL_4T98 | |
| SGC7901R cells | Uterus | Homo sapiens (Human) | CVCL_0520 | |
| In Vivo Model | Mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Annexin-V-FITC apoptosis detection assay; Caspase-3 activity assay; MTT assay; Trypan blue exclusion assay | |||
| Mechanism Description | miR-495 sensitizes MDR cancer cells to the combination of doxorubicin and taxol by inhibiting MDR1 expression, miR-495 was predicted to target ABCB1, which encodes protein MDR1. | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [4] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Platinum | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | ATP7A is a direct target gene of miR-495 and can be negatively regulated by miR-495. The inhibition of miR-495 reduced the cell sensitivity to CDDP in A549 and H1299 cells; miR-495 regulates the cell response to platinum drug resistance by modulation of ATP7A expression. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
