Molecule Information

General Information of the Molecule (ID: Mol01497)

• Name: hsa-mir-452 ,Homo sapiens
• Synonyms: microRNA 452
• Molecule Type: Precursor miRNA
• Gene Name: MIR452
• Gene ID: 574412
• Location: chrX:151959628-151959712[-]
• Sequence:
  GCUAAGCACUUACAACUGUUUGCAGAGGAAACUGAGACUUUGUAACUAUGUCUCAGUCUC
  AUCUGCAAAGAAGUAAGUGCUUUGC
• Ensembl ID: ENSG00000283751
• HGNC ID: HGNC:32054
• Precursor Accession: MI0001733

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-qPCR; Western blot
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: MiRNA-452 showed significantly higher expression (78.9-folds) in MCF-7/DOC cells compared to parental MCF-7 cells. The expression of miRNA-452 in the mimic transfected MCF-7 cells was upregulated 212.2-folds (P < 0.05) compared to its negative control (NC), and the half maximal inhibitory concentration (IC50) value of DOC (1.98 0.15 M) was significantly higher than that in its NC (0.85 0.08 M, P < 0.05) or blank control (1.01 0.19 M, P < 0.05). Furthermore, its apoptotic rate (6.3 1.3 %) was distinctly decreased compared with that in its NC (23.8 6.6 %, P < 0.05) or blank control (18.6 4.7 %, P < 0.05). In contrast, the expression of miRNA-452 in the inhibitor-transfected MCF-7/DOC cells was downregulated 0.58-fold (P < 0.05) compared to its NC, the IC50 value of DOC (44.5 3.2 M) was significantly lower than that in its NC (107.3 6.63 M, P < 0.05) or blank control (102.22 11.34 M, P < 0.05), and the apoptotic rate (45.5 10.8 %) was distinctly increased compared with its NC (9.9 2.2 %, P < 0.05) and blank control (9.4 2.5 %, P < 0.05). Further, there was an inverse association between miRNA-452 and APC4 expression in breast cancer cells in vitro.Dysregulation of miRNA-452 involved in the DOC resistance formation of breast cancer cells may be, in part, via targeting APC4.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-452 could modulate the sensitivity of breast cancer cells to ADR, maybe in part by regulating the expression of IGF-1R.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [3]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Differential gene expression between parental and gemcitabine-resistant pancreatic cancer cell. Consequently, compared with SW1990 cells, 28 microRNAs were upregulated and 28 microRNAs were decreased (fold change>=2) in SW1990/GEM cells. Then, the expression of some differential microRNAs was confirmed by Q-PCR assays. We found that miR-643, miR-1261, miR483-5p, miR-371a-5p, and miR-373-3p were upregulated and that the expression of miR-4455, miR-3676, miR-4650, miR4791, and miR-4644 was decreased in SW1990/GEM cells. Generally, the tendency of expression changes was consistent between microRNA-seq and Q-PCR results.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/ERK signaling; Regulation; N.A.
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• Experiment for Molecule Alteration: qRT-PCR, microarray assay
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Among these miRs, 7 (miR-224, miR-424-3p, miR-130a, miR-224-star, miR-452, miR-181a-2-star, and miR-193b-5p) were downregulated in the PTX-resistant GC cell line, whereas the other 3 miRs (miR-3127-5p, miR-1287, and miR-4713-5p) were upregulated in the PTX-resistant GC cell line compared to the PTX-sensitive GC cell line. AKT/ERK signaling was active in the PTX-resistant GC cell line.

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [4]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• Experiment for Molecule Alteration: MiRNA microarray
• Experiment for Drug Resistance: Water-soluble tetrazolium salt (WST)-based assay
• Mechanism Description: We then performed a comprehensive analysis of miRNA expressions in U251R and parental cells using miRNA microarrays. miR-195, miR-455-3p and miR-10a* were the three most up-regulated miRNAs in the resistant cells. Thirteen miRNAs were overexpressed (>2.0-fold) and two were underexpressed (<0.5-fold) in U251R cells compared to U251Wt cells. In addition, using in silico analysis combined with cDNA microarray experiment, we present possible mRNA targets of these miRNAs.

Clinical Trial Drug(s) 1 drug(s) in total

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [5]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: Down-regulation of miRNA-452 is associated with adriamycin-resistance in breast cancer cells. Asian Pac J Cancer Prev. 2014;15(13):5137-42. doi: 10.7314/apjcp.2014.15.13.5137.
• Ref 3: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 4: Molecular mechanism of chemoresistance by miR-215 in osteosarcoma and colon cancer cells. Mol Cancer. 2010 Apr 30;9:96. doi: 10.1186/1476-4598-9-96.
• Ref 5: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.