Molecule Information

General Information of the Molecule (ID: Mol01497)

• Name: hsa-mir-452 ,Homo sapiens
• Synonyms: microRNA 452
• Molecule Type: Precursor miRNA
• Gene Name: MIR452
• Gene ID: 574412
• Location: chrX:151959628-151959712[-]
• Sequence:
  GCUAAGCACUUACAACUGUUUGCAGAGGAAACUGAGACUUUGUAACUAUGUCUCAGUCUC
  AUCUGCAAAGAAGUAAGUGCUUUGC
• Ensembl ID: ENSG00000283751
• HGNC ID: HGNC:32054
• Precursor Accession: MI0001733

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-452 could modulate the sensitivity of breast cancer cells to ADR, maybe in part by regulating the expression of IGF-1R.

References

• Ref 1: Down-regulation of miRNA-452 is associated with adriamycin-resistance in breast cancer cells. Asian Pac J Cancer Prev. 2014;15(13):5137-42. doi: 10.7314/apjcp.2014.15.13.5137.