Molecule Information
General Information of the Molecule (ID: Mol01492)
Name |
hsa-mir-196b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 196b
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR196B
|
||||
Gene ID | |||||
Location |
chr7:27169480-27169563[-]
|
||||
Sequence |
ACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGAUCCACCUUUCUCUCGACAGCACG
ACACUGCCUUCAUUACUUCAGUUG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
c-Myc signaling pathway | Activation | hsa05230 | ||
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-196b overexpression decreased IGF2BP1 RNA expression and protein level. The IGF2BP1 down-regulation by either miR-196b or IGF2BP1 siRNA led to an increase in apoptosis and a decrease in cell viability and proliferation in normal culture conditions. However, IGF2BP1 silencing did not modify the chemoresistance induced by hypoxia, probably because it is not the only target of miR-196b involved in the regulation of apoptosis. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioma | [2] | |||
Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
Sensitive Drug | Temozolomide | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell colony | Inhibition | hsa05200 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | Down-regulation of miR-196b increased glioma cell sensitivity to TMZ and E2F1 decreased following transfection with miR-196b inhibitors. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.