General Information of the Molecule (ID: Mol01492)
Name
hsa-mir-196b ,Homo sapiens
Synonyms
microRNA 196b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR196B
Gene ID
442920
Location
chr7:27169480-27169563[-]
Sequence
ACUGGUCGGUGAUUUAGGUAGUUUCCUGUUGUUGGGAUCCACCUUUCUCUCGACAGCACG
ACACUGCCUUCAUUACUUCAGUUG
    Click to Show/Hide
Ensembl ID
ENSG00000283745
HGNC ID
HGNC:31790
Precursor Accession
MI0001150
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [1]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Etoposide
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
c-Myc signaling pathway Activation hsa05230
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-196b overexpression decreased IGF2BP1 RNA expression and protein level. The IGF2BP1 down-regulation by either miR-196b or IGF2BP1 siRNA led to an increase in apoptosis and a decrease in cell viability and proliferation in normal culture conditions. However, IGF2BP1 silencing did not modify the chemoresistance induced by hypoxia, probably because it is not the only target of miR-196b involved in the regulation of apoptosis.
Temozolomide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [2]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell colony Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Down-regulation of miR-196b increased glioma cell sensitivity to TMZ and E2F1 decreased following transfection with miR-196b inhibitors.
References
Ref 1 miRNA-196b inhibits cell proliferation and induces apoptosis in HepG2 cells by targeting IGF2BP1. Mol Cancer. 2015 Apr 8;14:79. doi: 10.1186/s12943-015-0349-6.
Ref 2 Downregulation of miR-196b Promotes Glioma Cell Sensitivity to Temozolomide Chemotherapy and Radiotherapy. Ann Clin Lab Sci. 2018 Nov;48(6):719-725.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.