Molecule Information
General Information of the Molecule (ID: Mol01491)
Name |
hsa-mir-335
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 335
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR335
|
||||
Gene ID | |||||
Location |
chr7:130496111-130496204[+]
|
||||
Sequence |
UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUU
AUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung small cell carcinoma | [1] | |||
Sensitive Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | NF-kappaB signaling pathway | Inhibition | hsa04064 | |
In Vitro Model | H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 |
H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
H446/DDP cells | Lung | Homo sapiens (Human) | CVCL_RT21 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Annexin V-PE Apoptosis assay; Flow cytometry assay; Wound healing assay; Colony formation assay | |||
Mechanism Description | miR335 might affect the chemosensitivity and radiosensitivity of SCLC by targeting PARP-1, which further affected NF-kB P65 protein levels, hence NF-kB pathway was involved in the regulation network. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Acute myeloid leukemia | [2] | |||
Resistant Disease | Acute myeloid leukemia [ICD-11: 2A60.0] | |||
Resistant Drug | Cytarabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell invasion | Activation | hsa05200 | ||
Cell migration | Activation | hsa04670 | ||
Cell proliferation | Activation | hsa05200 | ||
Nodal/TFG-alpha signaling pathway | Regulation | hsa04350 | ||
Wnt/alpha -catenin signaling pathway | Regulation | hsa04310 | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
Relapse-free survival and overall survival assay | |||
Mechanism Description | The expression levels of miR-335 in bone marrow and serum samples from adult patients with AML (except M3) were significantly associated with the Ara-C-based chemotherapy response and clinical outcome after treatment. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung small cell carcinoma | [1] | |||
Sensitive Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | NF-kappaB signaling pathway | Inhibition | hsa04064 | |
In Vitro Model | H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 |
H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
H446/DDP cells | Lung | Homo sapiens (Human) | CVCL_RT21 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Annexin V-PE Apoptosis assay; Flow cytometry assay; Wound healing assay; Colony formation assay | |||
Mechanism Description | Overexpression of miR335 sensitized human SCLC cells to chemotherapy and radiotherapy, promoted cell apoptosis and inhibited cell migration ability of human SCLC in vitro, and inhibited tumor growth in vivo. Overexpression of miR335 decreased the expression of PARP-1 mRNA and protein, and NF-kB protein levels were correspondingly downregulated, thus regulating the chemo-radiosensitivity of SCLC. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung small cell carcinoma | [1] | |||
Sensitive Disease | Lung small cell carcinoma [ICD-11: 2C25.2] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | NF-kappaB signaling pathway | Inhibition | hsa04064 | |
In Vitro Model | H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 |
H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
H446/DDP cells | Lung | Homo sapiens (Human) | CVCL_RT21 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Annexin V-PE Apoptosis assay; Flow cytometry assay; Wound healing assay; Colony formation assay | |||
Mechanism Description | Overexpression of miR335 sensitized human SCLC cells to chemotherapy and radiotherapy, promoted cell apoptosis and inhibited cell migration ability of human SCLC in vitro, and inhibited tumor growth in vivo. Overexpression of miR335 decreased the expression of PARP-1 mRNA and protein, and NF-kB protein levels were correspondingly downregulated, thus regulating the chemo-radiosensitivity of SCLC. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Melanoma | [3], [4] | |||
Sensitive Disease | Melanoma [ICD-11: 2C30.0] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
miR335/SIAH2/HDAC3 signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | Malme3M cells | Skin | Homo sapiens (Human) | CVCL_1438 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Trypan blue exclusion assay; Transwell assay | |||
Mechanism Description | miR-335-mediated increased sensitivity to anti-cancer drugs was associated with its effect on HDAC3 and SIAH2 expression. miR-335 exerted apoptotic effects and inhibited ubiquitination of HDAC3 in anti-cancer drug-resistant cancer cell lines. miR-335 negatively regulated the invasion, migration, and growth rate of cancer cells. The mouse xenograft model showed that miR-335 negatively regulated the tumorigenic potential of cancer cells. The down-regulation of SIAH2 conferred sensitivity to anti-cancer drugs. The results of the study indicated that the miR-335/SIAH2/HDAC3 axis regulates the response to anti-cancer drugs. | |||
Disease Class: Hepatocellular carcinoma | [4] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
miR335/SIAH2/HDAC3 signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | SNU387 cells | Liver | Homo sapiens (Human) | CVCL_0250 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Trypan blue exclusion assay; Transwell assay | |||
Mechanism Description | miR-335-mediated increased sensitivity to anti-cancer drugs was associated with its effect on HDAC3 and SIAH2 expression. miR-335 exerted apoptotic effects and inhibited ubiquitination of HDAC3 in anti-cancer drug-resistant cancer cell lines. miR-335 negatively regulated the invasion, migration, and growth rate of cancer cells. The mouse xenograft model showed that miR-335 negatively regulated the tumorigenic potential of cancer cells. The down-regulation of SIAH2 conferred sensitivity to anti-cancer drugs. The results of the study indicated that the miR-335/SIAH2/HDAC3 axis regulates the response to anti-cancer drugs. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Paediatric acute lymphocytic leukemia | [5] | |||
Sensitive Disease | Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] | |||
Sensitive Drug | Prednisolone | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
MAPK signaling pathway | Regulation | hsa04010 | ||
NF-kappaB signaling pathway | Regulation | hsa04064 | ||
In Vitro Model | MLL/AF4+ RS4 cells | Blood | Homo sapiens (Human) | CVCL_0093 |
697 cells | Bone marrow | Homo sapiens (Human) | CVCL_0079 | |
Sup-B15 cells | Bone marrow | Homo sapiens (Human) | CVCL_0103 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTS assay | |||
Mechanism Description | MAPk1 is a novel target of MIR335, and that MEk/ERk inhibitor treatment enhanced prednisolone-induced cell death through the activation of BIM (BCL2L11). |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [6] | |||
Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Resistant Drug | Sorafenib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
c-Met/AKT signaling pathway | Inhibition | hsa01521 | ||
In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
BEL-7404 cells | Liver | Homo sapiens (Human) | CVCL_6568 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR; Dual-luciferase reporter assay | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | LncRNA NEAT1 mediates Sora resistance of HCC cells by suppressing miR-335 expression, and disinhibition on c-Met-Akt signaling pathway. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [4] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Vinblastine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
miR335/SIAH2/HDAC3 signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | SNU387 cells | Liver | Homo sapiens (Human) | CVCL_0250 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Trypan blue exclusion assay; Transwell assay | |||
Mechanism Description | miR-335-mediated increased sensitivity to anti-cancer drugs was associated with its effect on HDAC3 and SIAH2 expression. miR-335 exerted apoptotic effects and inhibited ubiquitination of HDAC3 in anti-cancer drug-resistant cancer cell lines. miR-335 negatively regulated the invasion, migration, and growth rate of cancer cells. The mouse xenograft model showed that miR-335 negatively regulated the tumorigenic potential of cancer cells. The down-regulation of SIAH2 conferred sensitivity to anti-cancer drugs. The results of the study indicated that the miR-335/SIAH2/HDAC3 axis regulates the response to anti-cancer drugs. |
Investigative Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Melanoma | [3] | |||
Sensitive Disease | Melanoma [ICD-11: 2C30.0] | |||
Sensitive Drug | Celastrol | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
In Vitro Model | SNU387 cells | Liver | Homo sapiens (Human) | CVCL_0250 |
Malme3M cells | Skin | Homo sapiens (Human) | CVCL_1438 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.