General Information of the Molecule (ID: Mol01491)
Name
hsa-mir-335 ,Homo sapiens
Synonyms
microRNA 335
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR335
Gene ID
442904
Location
chr7:130496111-130496204[+]
Sequence
UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUU
AUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA
    Click to Show/Hide
Ensembl ID
ENSG00000199043
HGNC ID
HGNC:31773
Precursor Accession
MI0000816
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
11 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [1]
Sensitive Disease Lung small cell carcinoma [ICD-11: 2C25.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation NF-kappaB signaling pathway Inhibition hsa04064
In Vitro Model H69 cells Lung Homo sapiens (Human) CVCL_8121
H69AR cells Lung Homo sapiens (Human) CVCL_3513
H446 cells Lung Homo sapiens (Human) CVCL_1562
H446/DDP cells Lung Homo sapiens (Human) CVCL_RT21
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Annexin V-PE Apoptosis assay; Flow cytometry assay; Wound healing assay; Colony formation assay
Mechanism Description miR335 might affect the chemosensitivity and radiosensitivity of SCLC by targeting PARP-1, which further affected NF-kB P65 protein levels, hence NF-kB pathway was involved in the regulation network.
Cytarabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] [2]
Resistant Disease Acute myeloid leukemia [ICD-11: 2A60.0]
Resistant Drug Cytarabine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
Nodal/TFG-alpha signaling pathway Regulation N.A.
Wnt/alpha -catenin signaling pathway Regulation N.A.
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
Relapse-free survival and overall survival assay
Mechanism Description The expression levels of miR-335 in bone marrow and serum samples from adult patients with AML (except M3) were significantly associated with the Ara-C-based chemotherapy response and clinical outcome after treatment.
Daunorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [3]
Resistant Disease Acute lymphocytic leukemia [ICD-11: 2B33.0]
Resistant Drug Daunorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration
RT-qPCR; RT-PCR
Experiment for
Drug Resistance
Flow cytometry; MTT assay
Mechanism Description Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [1]
Sensitive Disease Lung small cell carcinoma [ICD-11: 2C25.2]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation NF-kappaB signaling pathway Inhibition hsa04064
In Vitro Model H69 cells Lung Homo sapiens (Human) CVCL_8121
H69AR cells Lung Homo sapiens (Human) CVCL_3513
H446 cells Lung Homo sapiens (Human) CVCL_1562
H446/DDP cells Lung Homo sapiens (Human) CVCL_RT21
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Annexin V-PE Apoptosis assay; Flow cytometry assay; Wound healing assay; Colony formation assay
Mechanism Description Overexpression of miR335 sensitized human SCLC cells to chemotherapy and radiotherapy, promoted cell apoptosis and inhibited cell migration ability of human SCLC in vitro, and inhibited tumor growth in vivo. Overexpression of miR335 decreased the expression of PARP-1 mRNA and protein, and NF-kB protein levels were correspondingly downregulated, thus regulating the chemo-radiosensitivity of SCLC.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung small cell carcinoma [ICD-11: 2C25.2] [1]
Sensitive Disease Lung small cell carcinoma [ICD-11: 2C25.2]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation NF-kappaB signaling pathway Inhibition hsa04064
In Vitro Model H69 cells Lung Homo sapiens (Human) CVCL_8121
H69AR cells Lung Homo sapiens (Human) CVCL_3513
H446 cells Lung Homo sapiens (Human) CVCL_1562
H446/DDP cells Lung Homo sapiens (Human) CVCL_RT21
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Annexin V-PE Apoptosis assay; Flow cytometry assay; Wound healing assay; Colony formation assay
Mechanism Description Overexpression of miR335 sensitized human SCLC cells to chemotherapy and radiotherapy, promoted cell apoptosis and inhibited cell migration ability of human SCLC in vitro, and inhibited tumor growth in vivo. Overexpression of miR335 decreased the expression of PARP-1 mRNA and protein, and NF-kB protein levels were correspondingly downregulated, thus regulating the chemo-radiosensitivity of SCLC.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] [4]
Resistant Disease Gastrointestinal stromal tumor [ICD-11: 2B5B.1]
Resistant Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model GIST patients and GIST patients who developed imatinib resistance Homo sapiens
Experiment for
Molecule Alteration
qRT-PCR
Mechanism Description Compared with the primary GISTs, the expression levels of five genes (hsa-miR-15a, hsa-miR-16, hsa-miR-195, hsa-miR-335, and hsa-miR-151-5p) were upregulated and the levels of eight genes (hsa-miR-1280, hsa-miR-140-5p, hsa-miR-320a, hsa-miR-135b, hsa-miR-664*, hsa-miR-483-5p, hsa-miR-140-3p, and hsa-miR-574-3p) were downregulated in imatinib-resistant GISTs
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [5]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
LOVO cells Colon Homo sapiens (Human) CVCL_0399
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The hsa-miR-335 was found to have an indispensable role in downregulation of numerous DEGs. Consistent with this finding, overexpression of hsa-miR-335 in CRC and gastric cancer cells has been reported, previously [59, 60]. Yan et al. [59] stated that this miRNA participated in the regulation of some critical oncogenic signaling pathways including p53, Wnt, ErbB, MAPK, and TGF-beta, and its overexpression was associated with the high frequency recurrence and poor survival. More interestingly, hsa-miR-335 is located on chromosome 7, and LoVo cells possess trisomy of this chromosome [61]. This suggests a distinct function of this miRNA in acquired resistance of LoVo cells to chemotherapeutic drugs.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [6], [7]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
miR335/SIAH2/HDAC3 signaling pathway Regulation N.A.
In Vitro Model Malme3M cells Skin Homo sapiens (Human) CVCL_1438
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Trypan blue exclusion assay; Transwell assay
Mechanism Description miR-335-mediated increased sensitivity to anti-cancer drugs was associated with its effect on HDAC3 and SIAH2 expression. miR-335 exerted apoptotic effects and inhibited ubiquitination of HDAC3 in anti-cancer drug-resistant cancer cell lines. miR-335 negatively regulated the invasion, migration, and growth rate of cancer cells. The mouse xenograft model showed that miR-335 negatively regulated the tumorigenic potential of cancer cells. The down-regulation of SIAH2 conferred sensitivity to anti-cancer drugs. The results of the study indicated that the miR-335/SIAH2/HDAC3 axis regulates the response to anti-cancer drugs.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [7]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
miR335/SIAH2/HDAC3 signaling pathway Regulation N.A.
In Vitro Model SNU387 cells Liver Homo sapiens (Human) CVCL_0250
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Trypan blue exclusion assay; Transwell assay
Mechanism Description miR-335-mediated increased sensitivity to anti-cancer drugs was associated with its effect on HDAC3 and SIAH2 expression. miR-335 exerted apoptotic effects and inhibited ubiquitination of HDAC3 in anti-cancer drug-resistant cancer cell lines. miR-335 negatively regulated the invasion, migration, and growth rate of cancer cells. The mouse xenograft model showed that miR-335 negatively regulated the tumorigenic potential of cancer cells. The down-regulation of SIAH2 conferred sensitivity to anti-cancer drugs. The results of the study indicated that the miR-335/SIAH2/HDAC3 axis regulates the response to anti-cancer drugs.
Prednisolone
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4] [8]
Sensitive Disease Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
Sensitive Drug Prednisolone
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
MAPK signaling pathway Regulation N.A.
NF-kappaB signaling pathway Regulation N.A.
In Vitro Model MLL/AF4+ RS4 cells Blood Homo sapiens (Human) CVCL_0093
697 cells Bone marrow Homo sapiens (Human) CVCL_0079
Sup-B15 cells Bone marrow Homo sapiens (Human) CVCL_0103
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description MAPk1 is a novel target of MIR335, and that MEk/ERk inhibitor treatment enhanced prednisolone-induced cell death through the activation of BIM (BCL2L11).
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [9]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Sorafenib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
c-Met/AKT signaling pathway Inhibition hsa01521
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
BEL-7404 cells Liver Homo sapiens (Human) CVCL_6568
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Dual-luciferase reporter assay
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description LncRNA NEAT1 mediates Sora resistance of HCC cells by suppressing miR-335 expression, and disinhibition on c-Met-Akt signaling pathway.
Vinblastine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [7]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Vinblastine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
miR335/SIAH2/HDAC3 signaling pathway Regulation N.A.
In Vitro Model SNU387 cells Liver Homo sapiens (Human) CVCL_0250
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Trypan blue exclusion assay; Transwell assay
Mechanism Description miR-335-mediated increased sensitivity to anti-cancer drugs was associated with its effect on HDAC3 and SIAH2 expression. miR-335 exerted apoptotic effects and inhibited ubiquitination of HDAC3 in anti-cancer drug-resistant cancer cell lines. miR-335 negatively regulated the invasion, migration, and growth rate of cancer cells. The mouse xenograft model showed that miR-335 negatively regulated the tumorigenic potential of cancer cells. The down-regulation of SIAH2 conferred sensitivity to anti-cancer drugs. The results of the study indicated that the miR-335/SIAH2/HDAC3 axis regulates the response to anti-cancer drugs.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Celastrol
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [6]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
Sensitive Drug Celastrol
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model SNU387 cells Liver Homo sapiens (Human) CVCL_0250
Malme3M cells Skin Homo sapiens (Human) CVCL_1438
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.
References
Ref 1 MiR-335 regulates the chemo-radioresistance of small cell lung cancer cells by targeting PARP-1. Gene. 2017 Feb 5;600:9-15. doi: 10.1016/j.gene.2016.11.031. Epub 2016 Nov 19.
Ref 2 Bone Marrow MicroRNA-335 Level Predicts the Chemotherapy Response and Prognosis of Adult Acute Myeloid Leukemia. Medicine (Baltimore). 2015 Aug;94(33):e0986. doi: 10.1097/MD.0000000000000986.
Ref 3 BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
Ref 4 The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
Ref 5 Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
Ref 6 miR-326-histone deacetylase-3 feedback loop regulates the invasion and tumorigenic and angiogenic response to anti-cancer drugs. J Biol Chem. 2014 Oct 3;289(40):28019-39. doi: 10.1074/jbc.M114.578229. Epub 2014 Aug 19.
Ref 7 miR-335 Targets SIAH2 and Confers Sensitivity to Anti-Cancer Drugs by Increasing the Expression of HDAC3. Mol Cells. 2015 Jun;38(6):562-72. doi: 10.14348/molcells.2015.0051. Epub 2015 May 22.
Ref 8 Deregulated MIR335 that targets MAPK1 is implicated in poor outcome of paediatric acute lymphoblastic leukaemia. Br J Haematol. 2013 Oct;163(1):93-103. doi: 10.1111/bjh.12489. Epub 2013 Jul 25.
Ref 9 Long noncoding RNA NEAT1 suppresses sorafenib sensitivity of hepatocellular carcinoma cells via regulating miR-335-c-Met. J Cell Physiol. 2019 Apr 1. doi: 10.1002/jcp.27567. Online ahead of print.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.