Molecule Information
General Information of the Molecule (ID: Mol01487)
| Name |
hsa-mir-151a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 151a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR151A
|
||||
| Gene ID | |||||
| Location |
chr8:140732564-140732653[-]
|
||||
| Sequence |
UUUCCUGCCCUCGAGGAGCUCACAGUCUAGUAUGUCUCAUCCCCUACUAGACUGAAGCUC
CUUGAGGACAGGGAUGGUCAUACUCACCUC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [1] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
qRT-PCR; Western blot; Dual luciferase assay | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [2] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [3] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | J82 cells | Bladder | Homo sapiens (Human) | CVCL_0359 |
| UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
| RT4 cells | Bladder | Homo sapiens (Human) | CVCL_0036 | |
| RT112 cells | Bladder | Homo sapiens (Human) | CVCL_1670 | |
| Experiment for Molecule Alteration |
Western blot; Microarray Analysis; qRT-PCR | |||
| Experiment for Drug Resistance |
Proliferation Assay | |||
| Mechanism Description | Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] | [3] | |||
| Resistant Disease | Gastrointestinal stromal tumor [ICD-11: 2B5B.1] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | GIST patients and GIST patients who developed imatinib resistance | Homo sapiens | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Mechanism Description | Compared with the primary GISTs, the expression levels of five genes (hsa-miR-15a, hsa-miR-16, hsa-miR-195, hsa-miR-335, and hsa-miR-151-5p) were upregulated and the levels of eight genes (hsa-miR-1280, hsa-miR-140-5p, hsa-miR-320a, hsa-miR-135b, hsa-miR-664*, hsa-miR-483-5p, hsa-miR-140-3p, and hsa-miR-574-3p) were downregulated in imatinib-resistant GISTs | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [4] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
| LCC9 cells | Breast | Homo sapiens (Human) | CVCL_DP52 | |
| Experiment for Molecule Alteration |
Microarray analyses; qPCR; RT-PCR; Western blot | |||
| Mechanism Description | Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [5] | |||
| Resistant Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell colony | Activation | hsa05200 | ||
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
| A172 cells | Brain | Homo sapiens (Human) | CVCL_0131 | |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| T98G cells | Brain | Homo sapiens (Human) | CVCL_0556 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Inhibiting miR-151a leads to increased XRCC4 levels, resulting in activated DNA repair and subsequent resistance to TMZ. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [2] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Verapamil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
