Molecule Information

General Information of the Molecule (ID: Mol01487)

• Name: hsa-mir-151a ,Homo sapiens
• Synonyms: microRNA 151a
• Molecule Type: Precursor miRNA
• Gene Name: MIR151A
• Gene ID: 442893
• Location: chr8:140732564-140732653[-]
• Sequence:
  UUUCCUGCCCUCGAGGAGCUCACAGUCUAGUAUGUCUCAUCCCCUACUAGACUGAAGCUC
  CUUGAGGACAGGGAUGGUCAUACUCACCUC
• Ensembl ID: ENSG00000254324
• HGNC ID: HGNC:31762
• Precursor Accession: MI0000809

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Temozolomide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [1]

• Resistant Disease: Glioblastoma [ICD-11: 2A00.02]
• Resistant Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell colony; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: LN229 cells; Brain; Homo sapiens (Human); CVCL_0393
• In Vitro Model: A172 cells; Brain; Homo sapiens (Human); CVCL_0131
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Inhibiting miR-151a leads to increased XRCC4 levels, resulting in activated DNA repair and subsequent resistance to TMZ.

References

• Ref 1: Exosomal transfer of miR-151a enhances chemosensitivity to temozolomide in drug-resistant glioblastoma. Cancer Lett. 2018 Nov 1;436:10-21. doi: 10.1016/j.canlet.2018.08.004. Epub 2018 Aug 10.