Molecule Information
General Information of the Molecule (ID: Mol01487)
| Name |
hsa-mir-151a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 151a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR151A
|
||||
| Gene ID | |||||
| Location |
chr8:140732564-140732653[-]
|
||||
| Sequence |
UUUCCUGCCCUCGAGGAGCUCACAGUCUAGUAUGUCUCAUCCCCUACUAGACUGAAGCUC
CUUGAGGACAGGGAUGGUCAUACUCACCUC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [1] | |||
| Resistant Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell colony | Activation | hsa05200 | ||
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
| A172 cells | Brain | Homo sapiens (Human) | CVCL_0131 | |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| T98G cells | Brain | Homo sapiens (Human) | CVCL_0556 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Inhibiting miR-151a leads to increased XRCC4 levels, resulting in activated DNA repair and subsequent resistance to TMZ. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
