Molecule Information
General Information of the Molecule (ID: Mol01484)
| Name |
hsa-mir-328
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 328
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR328
|
||||
| Gene ID | |||||
| Location |
chr16:67202321-67202395[-]
|
||||
| Sequence |
UGGAGUGGGGGGGCAGGAGGGGCUCAGGGAGAAAGUGCAUACAGCCCCUGGCCCUCUCUG
CCCUUCCGUCCCCUG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miRNA 328 overexpression confers cisplatin resistance in non small cell lung cancer via targeting of PTEN. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [2] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | KG-1 cells | Bone marrow | Homo sapiens (Human) | CVCL_0374 |
| K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | LncRNA MALAT1 promotes cell proliferation and imatinib resistance by suppressing miR-328 in chronic myelogenous leukemia. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Mitoxantrone | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7/MX100 cells | Breast | Homo sapiens (Human) | CVCL_LB54 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Sulforhodamine B assay | |||
| Mechanism Description | miR-328 targets ABCG2 3'-UTR and, consequently, controls ABCG2 protein expression and influences drug disposition in human breast cancer cells. miR-328-directed down-regulation of ABCG2 expression in MCF-7/MX100 cells resulted in an increased mitoxantrone sensitivity. | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [4] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Hydroxycamptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| SW1116 cells | Colon | Homo sapiens (Human) | CVCL_0544 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | MMP16 is one member of the matrix metalloproteinase (MMP) family and can degrade type III collagen, gelatin, fibronectin and laminin-1, enhance the growth and invasiveness. ABCG2 is a member of ATP-binding cassette transporters. miR-328 downregulation may contribute to the overexpression of ABCG2 and MMP16 and cause drug resistance. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
