Molecule Information

General Information of the Molecule (ID: Mol01479)

• Name: hsa-mir-381 ,Homo sapiens
• Synonyms: microRNA 381
• Molecule Type: Precursor miRNA
• Gene Name: MIR381
• Gene ID: 494330
• Location: chr14:101045920-101045994[+]
• Sequence:
  UACUUAAAGCGAGGUUGCCCUUUGUAUAUUCGGUUUAUUGACAUGGAAUAUACAAGGGCA
  AGCUCUCUGUGAGUA
• Ensembl ID: ENSG00000199020
• HGNC ID: HGNC:31874
• Precursor Accession: MI0000789

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: NF-kB signaling pathway; Inhibition; hsa04218
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: NCI-H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR381 suppresses the growth and increases cisplatin sensitivity in non-small cell lung cancer cells through inhibition of nuclear factor-kB signaling. miR381 suppresses the activation of NF-kB signaling by targeting ID1.

Disease Class: Osteosarcoma [2]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: mTOR signaling pathway; Regulation; hsa04150
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Matrigel chamber invasion assay
• Mechanism Description: There is a strong negative correlation between the expression of miR381 and LRRC4, suppressing the expression of miR381 increases the sensitivity of OS cells to chemotherapeutic drugs through the LRRC4-mediated mTOR pathway.

Disease Class: Breast cancer [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: miR-381 could overcome DDP resistance of breast cancer by directly targeting MDR1.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: MAPK signaling pathway; Activation; hsa04010
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-381 inactivated MAPk signaling by down-regulating FYN, thereby promoting the chemosensitization of breast cancer cells to DOX.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Kidney cancer [5]

• Sensitive Disease: Kidney cancer [ICD-11: 2C90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: WEE1/Cdc2 signaling pathway; Activation; hsa04110
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vitro Model: HK-2 cells; Kidney; Homo sapiens (Human); CVCL_0302
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-381 increases sensitivity of 786-O cells to 5-FU by inhibitory WEE1 and increase of Cdc2activity.

References

• Ref 1: microRNA-381 suppresses the growth and increases cisplatin sensitivity in non-small cell lung cancer cells through inhibition of nuclear factor-kB signaling. Biomed Pharmacother. 2018 Feb;98:538-544. doi: 10.1016/j.biopha.2017.12.092. Epub 2017 Dec 27.
• Ref 2: Low expression of miR-381 is a favorite prognosis factor and enhances the chemosensitivity of osteosarcoma. Oncotarget. 2016 Oct 18;7(42):68585-68596. doi: 10.18632/oncotarget.11861.
• Ref 3: miR-381 overcomes cisplatin resistance in breast cancer by targeting MDR1. Cell Biol Int. 2019 Jan;43(1):12-21. doi: 10.1002/cbin.11071.
• Ref 4: miR-381 induces sensitivity of breast cancer cells to doxorubicin by inactivation of MAPK signaling via FYN. Eur J Pharmacol. 2018 Nov 15;839:66-75. doi: 10.1016/j.ejphar.2018.09.024. Epub 2018 Sep 26.
• Ref 5: miR-381, a novel intrinsic WEE1 inhibitor, sensitizes renal cancer cells to 5-FU by up-regulation of Cdc2 activities in 786-O. J Chemother. 2013 Aug;25(4):229-38. doi: 10.1179/1973947813Y.0000000092. Epub 2013 May 7.