Molecule Information
General Information of the Molecule (ID: Mol01479)
| Name |
hsa-mir-381
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 381
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR381
|
||||
| Gene ID | |||||
| Location |
chr14:101045920-101045994[+]
|
||||
| Sequence |
UACUUAAAGCGAGGUUGCCCUUUGUAUAUUCGGUUUAUUGACAUGGAAUAUACAAGGGCA
AGCUCUCUGUGAGUA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | NF-kB signaling pathway | Inhibition | hsa04218 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| NCI-H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR381 suppresses the growth and increases cisplatin sensitivity in non-small cell lung cancer cells through inhibition of nuclear factor-kB signaling. miR381 suppresses the activation of NF-kB signaling by targeting ID1. | |||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | mTOR signaling pathway | Regulation | N.A. | |
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Matrigel chamber invasion assay | |||
| Mechanism Description | There is a strong negative correlation between the expression of miR381 and LRRC4, suppressing the expression of miR381 increases the sensitivity of OS cells to chemotherapeutic drugs through the LRRC4-mediated mTOR pathway. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-381 could overcome DDP resistance of breast cancer by directly targeting MDR1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [4] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | . |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | TOV21G cells | Ovary | Homo sapiens (Human) | CVCL_3613 |
| TOV112D cells | Ovary | Homo sapiens (Human) | CVCL_3612 | |
| C13 cells | Ovary | Homo sapiens (Human) | CVCL_0114 | |
| OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
| A2780CP cells | Ovary | Homo sapiens (Human) | CVCL_0135 | |
| A2780s cells | Ovary | Homo sapiens (Human) | CVCL_4863 | |
| IGROV1 cells | Ovary | Homo sapiens (Human) | CVCL_1304 | |
| OVCAR5 cells | Ovary | Homo sapiens (Human) | CVCL_1628 | |
| OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
| SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 | |
| Experiment for Molecule Alteration |
miRNA probe assay | |||
| Experiment for Drug Resistance |
Cell proliferation assays | |||
| Mechanism Description | MicroRNAs (miRNAs) are 19 to 25-nucleotide, non-coding, RNA transcripts, thought to be instrumental in controlling eukaryotic cell function via modulation of post-transcriptional activity of multiple target mRNA genes by repression of translation or regulation of mRNA degradation. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [5] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell viability | Activation | hsa05200 | ||
| MAPK signaling pathway | Activation | hsa04010 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-381 inactivated MAPk signaling by down-regulating FYN, thereby promoting the chemosensitization of breast cancer cells to DOX. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Kidney cancer [ICD-11: 2C90.1] | [6] | |||
| Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell colony | Inhibition | hsa05200 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| WEE1/Cdc2 signaling pathway | Activation | hsa04110 | ||
| In Vitro Model | 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 |
| HK-2 cells | Kidney | Homo sapiens (Human) | CVCL_0302 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-381 increases sensitivity of 786-O cells to 5-FU by inhibitory WEE1 and increase of Cdc2activity. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
