General Information of the Molecule (ID: Mol01479)
Name
hsa-mir-381 ,Homo sapiens
Synonyms
microRNA 381
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR381
Gene ID
494330
Location
chr14:101045920-101045994[+]
Sequence
UACUUAAAGCGAGGUUGCCCUUUGUAUAUUCGGUUUAUUGACAUGGAAUAUACAAGGGCA
AGCUCUCUGUGAGUA
    Click to Show/Hide
Ensembl ID
ENSG00000199020
HGNC ID
HGNC:31874
Precursor Accession
MI0000789
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation NF-kB signaling pathway Inhibition hsa04218
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H460 cells Lung Homo sapiens (Human) CVCL_0459
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR381 suppresses the growth and increases cisplatin sensitivity in non-small cell lung cancer cells through inhibition of nuclear factor-kB signaling. miR381 suppresses the activation of NF-kB signaling by targeting ID1.
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [2]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation mTOR signaling pathway Regulation N.A.
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Matrigel chamber invasion assay
Mechanism Description There is a strong negative correlation between the expression of miR381 and LRRC4, suppressing the expression of miR381 increases the sensitivity of OS cells to chemotherapeutic drugs through the LRRC4-mediated mTOR pathway.
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-381 could overcome DDP resistance of breast cancer by directly targeting MDR1.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [4]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
MAPK signaling pathway Activation hsa04010
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-381 inactivated MAPk signaling by down-regulating FYN, thereby promoting the chemosensitization of breast cancer cells to DOX.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Kidney cancer [ICD-11: 2C90.1] [5]
Sensitive Disease Kidney cancer [ICD-11: 2C90.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell colony Inhibition hsa05200
Cell proliferation Inhibition hsa05200
WEE1/Cdc2 signaling pathway Activation hsa04110
In Vitro Model 786-O cells Kidney Homo sapiens (Human) CVCL_1051
HK-2 cells Kidney Homo sapiens (Human) CVCL_0302
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-381 increases sensitivity of 786-O cells to 5-FU by inhibitory WEE1 and increase of Cdc2activity.
References
Ref 1 microRNA-381 suppresses the growth and increases cisplatin sensitivity in non-small cell lung cancer cells through inhibition of nuclear factor-kB signaling. Biomed Pharmacother. 2018 Feb;98:538-544. doi: 10.1016/j.biopha.2017.12.092. Epub 2017 Dec 27.
Ref 2 Low expression of miR-381 is a favorite prognosis factor and enhances the chemosensitivity of osteosarcoma. Oncotarget. 2016 Oct 18;7(42):68585-68596. doi: 10.18632/oncotarget.11861.
Ref 3 miR-381 overcomes cisplatin resistance in breast cancer by targeting MDR1. Cell Biol Int. 2019 Jan;43(1):12-21. doi: 10.1002/cbin.11071.
Ref 4 miR-381 induces sensitivity of breast cancer cells to doxorubicin by inactivation of MAPK signaling via FYN. Eur J Pharmacol. 2018 Nov 15;839:66-75. doi: 10.1016/j.ejphar.2018.09.024. Epub 2018 Sep 26.
Ref 5 miR-381, a novel intrinsic WEE1 inhibitor, sensitizes renal cancer cells to 5-FU by up-regulation of Cdc2 activities in 786-O. J Chemother. 2013 Aug;25(4):229-38. doi: 10.1179/1973947813Y.0000000092. Epub 2013 May 7.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.