Molecule Information
General Information of the Molecule (ID: Mol01479)
Name |
hsa-mir-381
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 381
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR381
|
||||
Gene ID | |||||
Location |
chr14:101045920-101045994[+]
|
||||
Sequence |
UACUUAAAGCGAGGUUGCCCUUUGUAUAUUCGGUUUAUUGACAUGGAAUAUACAAGGGCA
AGCUCUCUGUGAGUA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | NF-kB signaling pathway | Inhibition | hsa04218 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
NCI-H460 cells | Lung | Homo sapiens (Human) | CVCL_0459 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR381 suppresses the growth and increases cisplatin sensitivity in non-small cell lung cancer cells through inhibition of nuclear factor-kB signaling. miR381 suppresses the activation of NF-kB signaling by targeting ID1. | |||
Disease Class: Osteosarcoma | [2] | |||
Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | mTOR signaling pathway | Regulation | hsa04150 | |
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Matrigel chamber invasion assay | |||
Mechanism Description | There is a strong negative correlation between the expression of miR381 and LRRC4, suppressing the expression of miR381 increases the sensitivity of OS cells to chemotherapeutic drugs through the LRRC4-mediated mTOR pathway. | |||
Disease Class: Breast cancer | [3] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR-381 could overcome DDP resistance of breast cancer by directly targeting MDR1. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [4] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell viability | Activation | hsa05200 | ||
MAPK signaling pathway | Activation | hsa04010 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-381 inactivated MAPk signaling by down-regulating FYN, thereby promoting the chemosensitization of breast cancer cells to DOX. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Kidney cancer | [5] | |||
Sensitive Disease | Kidney cancer [ICD-11: 2C90.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell colony | Inhibition | hsa05200 | ||
Cell proliferation | Inhibition | hsa05200 | ||
WEE1/Cdc2 signaling pathway | Activation | hsa04110 | ||
In Vitro Model | 786-O cells | Kidney | Homo sapiens (Human) | CVCL_1051 |
HK-2 cells | Kidney | Homo sapiens (Human) | CVCL_0302 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-381 increases sensitivity of 786-O cells to 5-FU by inhibitory WEE1 and increase of Cdc2activity. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.