General Information of the Molecule (ID: Mol01475)
Name
hsa-mir-377 ,Homo sapiens
Synonyms
microRNA 377
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR377
Gene ID
494326
Location
chr14:101062050-101062118[+]
Sequence
UUGAGCAGAGGUUGCCCUUGGUGAAUUCGCUUUAUUUAUGUUGAAUCACACAAAGGCAAC
UUUUGUUUG
    Click to Show/Hide
Ensembl ID
ENSG00000199015
HGNC ID
HGNC:31870
Precursor Accession
MI0000785
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [1]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
MG63/CDDP cells Bone Homo sapiens (Human) CVCL_0426
SAOS-2/CDDP cells Bone Homo sapiens (Human) CVCL_0548
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description XIAP overexpression greatly cancelled the apoptosis promoting the effect of miR377 in Saos-2/CDDP cell.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [2]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
miR377/CASP1 signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
PC9 cells Lung Homo sapiens (Human) CVCL_B260
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description SNHG5 overexpression sensitized gefitinib resistant LAD cells to gefitinib treatment; Overexpression of SNHG5 suppressed the expression of miR-377; Overexpression of miR-377 suppressed the expression of CASP1 in PC9 cells; knockdown of CASP1 in SNHG5-overexpressed PC9GR cells abolished their gefitinib resistance.
References
Ref 1 Down-regulation of miR-377 contributes to cisplatin resistance by targeting XIAP in osteosarcoma. Eur Rev Med Pharmacol Sci. 2018 Mar;22(5):1249-1257. doi: 10.26355/eurrev_201803_14465.
Ref 2 The long non-coding RNA SNHG5 regulates gefitinib resistance in lung adenocarcinoma cells by targetting miR-377/CASP1 axis. Biosci Rep. 2018 Aug 29;38(4):BSR20180400. doi: 10.1042/BSR20180400. Print 2018 Aug 31.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.