Molecule Information
General Information of the Molecule (ID: Mol01475)
Name |
hsa-mir-377
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 377
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR377
|
||||
Gene ID | |||||
Location |
chr14:101062050-101062118[+]
|
||||
Sequence |
UUGAGCAGAGGUUGCCCUUGGUGAAUUCGCUUUAUUUAUGUUGAAUCACACAAAGGCAAC
UUUUGUUUG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [1] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
MG63/CDDP cells | Bone | Homo sapiens (Human) | CVCL_0426 | |
SAOS-2/CDDP cells | Bone | Homo sapiens (Human) | CVCL_0548 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | XIAP overexpression greatly cancelled the apoptosis promoting the effect of miR377 in Saos-2/CDDP cell. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung adenocarcinoma | [2] | |||
Sensitive Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
Sensitive Drug | Gefitinib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
miR377/CASP1 signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | SNHG5 overexpression sensitized gefitinib resistant LAD cells to gefitinib treatment; Overexpression of SNHG5 suppressed the expression of miR-377; Overexpression of miR-377 suppressed the expression of CASP1 in PC9 cells; knockdown of CASP1 in SNHG5-overexpressed PC9GR cells abolished their gefitinib resistance. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.