Molecule Information

General Information of the Molecule (ID: Mol01475)

• Name: hsa-mir-377 ,Homo sapiens
• Synonyms: microRNA 377
• Molecule Type: Precursor miRNA
• Gene Name: MIR377
• Gene ID: 494326
• Location: chr14:101062050-101062118[+]
• Sequence:
  UUGAGCAGAGGUUGCCCUUGGUGAAUUCGCUUUAUUUAUGUUGAAUCACACAAAGGCAAC
  UUUUGUUUG
• Ensembl ID: ENSG00000199015
• HGNC ID: HGNC:31870
• Precursor Accession: MI0000785

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [1]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: MG63/CDDP cells; Bone; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2/CDDP cells; Bone; Homo sapiens (Human); CVCL_0548
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: XIAP overexpression greatly cancelled the apoptosis promoting the effect of miR377 in Saos-2/CDDP cell.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [2]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; FACS analysis
• Mechanism Description: Using the microRNA.org and TargetScan databases, approximately 14 of the down-regulated miRs are predicted to target the 3'-UTR of the MDR1 gene. Expression of hsa-mir-377 decreases.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [3]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: miR377/CASP1 signaling pathway; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: SNHG5 overexpression sensitized gefitinib resistant LAD cells to gefitinib treatment; Overexpression of SNHG5 suppressed the expression of miR-377; Overexpression of miR-377 suppressed the expression of CASP1 in PC9 cells; knockdown of CASP1 in SNHG5-overexpressed PC9GR cells abolished their gefitinib resistance.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [2]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HuH28 cells; Bile duct; Homo sapiens (Human); CVCL_2955
• In Vitro Model: HuCCT1 cells; Bile duct; Homo sapiens (Human); CVCL_0324
• Experiment for Molecule Alteration: MiRNA microarray
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Next we compared the HuH28 and HuCCT1 cell lines with regard to their innate miRNA expression profiles. Because HuCCT1 cells were more sensitive to Gem than were HuH28 cells, HuCCT1 cells were used as the standard in this comparison; expression of 10 miRNAs (miR-29b, 130a, 141, 200a, 200b, 200c, 205, 221, 222 and 429) was downregulated in HuH28 cells, while expression of eight others (miR-99b, 125a-5p, 143, 377, 452, 589, 597, and 708) was upregulated.

Paclitaxel

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant glioma [ICD-11: 2A00.02] [2]

• Sensitive Disease: Malignant glioma [ICD-11: 2A00.02]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: MCAS cells; Ovary; Homo sapiens (Human); CVCL_3020
• In Vitro Model: OVCA429 cells; Ovary; Homo sapiens (Human); CVCL_3936
• In Vitro Model: OVCA432 cells; Ovary; Homo sapiens (Human); CVCL_3769
• In Vitro Model: OVCA433 cells; Ovary; Homo sapiens (Human); CVCL_0475
• In Vitro Model: PEO1 cells; Ovary; Homo sapiens (Human); CVCL_2686
• In Vitro Model: PEO4 cells; Ovary; Homo sapiens (Human); CVCL_2690
• In Vitro Model: TOV-112D cells; Ovary; Homo sapiens (Human); CVCL_3612
• In Vitro Model: TOV21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• In Vitro Model: OVCAR10 cells; Ovary; Homo sapiens (Human); CVCL_4377
• In Vitro Model: OVCAR8 cells; Ovary; Homo sapiens (Human); CVCL_1629
• In Vitro Model: OVCAR5 cells; Ovary; Homo sapiens (Human); CVCL_1628
• In Vitro Model: OVCAR4 cells; Ovary; Homo sapiens (Human); CVCL_1627
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Based on miRNA expression and GI50 data, Pearson's correlation test identified 35 miRNAs associated with in vitro paclitaxel sensitivity (P<0.05).

References

• Ref 1: Down-regulation of miR-377 contributes to cisplatin resistance by targeting XIAP in osteosarcoma. Eur Rev Med Pharmacol Sci. 2018 Mar;22(5):1249-1257. doi: 10.26355/eurrev_201803_14465.
• Ref 2: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 3: The long non-coding RNA SNHG5 regulates gefitinib resistance in lung adenocarcinoma cells by targetting miR-377/CASP1 axis. Biosci Rep. 2018 Aug 29;38(4):BSR20180400. doi: 10.1042/BSR20180400. Print 2018 Aug 31.