Molecule Information

General Information of the Molecule (ID: Mol01475)

• Name: hsa-mir-377 ,Homo sapiens
• Synonyms: microRNA 377
• Molecule Type: Precursor miRNA
• Gene Name: MIR377
• Gene ID: 494326
• Location: chr14:101062050-101062118[+]
• Sequence:
  UUGAGCAGAGGUUGCCCUUGGUGAAUUCGCUUUAUUUAUGUUGAAUCACACAAAGGCAAC
  UUUUGUUUG
• Ensembl ID: ENSG00000199015
• HGNC ID: HGNC:31870
• Precursor Accession: MI0000785

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: MG63/CDDP cells; Bone; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2/CDDP cells; Bone; Homo sapiens (Human); CVCL_0548
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: XIAP overexpression greatly cancelled the apoptosis promoting the effect of miR377 in Saos-2/CDDP cell.

Gefitinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [2]

• Sensitive Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: miR377/CASP1 signaling pathway; Regulation; hsa05206
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: SNHG5 overexpression sensitized gefitinib resistant LAD cells to gefitinib treatment; Overexpression of SNHG5 suppressed the expression of miR-377; Overexpression of miR-377 suppressed the expression of CASP1 in PC9 cells; knockdown of CASP1 in SNHG5-overexpressed PC9GR cells abolished their gefitinib resistance.

References

• Ref 1: Down-regulation of miR-377 contributes to cisplatin resistance by targeting XIAP in osteosarcoma. Eur Rev Med Pharmacol Sci. 2018 Mar;22(5):1249-1257. doi: 10.26355/eurrev_201803_14465.
• Ref 2: The long non-coding RNA SNHG5 regulates gefitinib resistance in lung adenocarcinoma cells by targetting miR-377/CASP1 axis. Biosci Rep. 2018 Aug 29;38(4):BSR20180400. doi: 10.1042/BSR20180400. Print 2018 Aug 31.