Molecule Information
General Information of the Molecule (ID: Mol01462)
| Name |
hsa-mir-296
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 296
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR296
|
||||
| Gene ID | |||||
| Location |
chr20:58817615-58817694[-]
|
||||
| Sequence |
AGGACCCUUCCAGAGGGCCCCCCCUCAAUCCUGUUGUGCCUAAUUCAGAGGGUUGGGUGG
AGGCUCUCCUGAAGGGCUCU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [1] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Capecitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
Response evaluation criteria in solid tumors assay | |||
| Mechanism Description | The patients with decrease in miR-296 at 4 weeks may reflect a more aggressive tumor phenotype with increased metastasis and tumor cell invasiveness. The loss of miR-296 may be one of the mechanisms for primary resistance of colorectal cancer to chemotherapy. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell growth | Inhibition | hsa05200 | ||
| In Vitro Model | ECA-109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 |
| Experiment for Molecule Alteration |
RT-PCR; Northern blotting analysis | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | Down-regulation of miR-296 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs on esophageal cancer cells, and might promote ADR-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of ADR. Down-regulation of miR-296 could significantly decrease the expression of P-glycoprotein, Bcl-2, and the transcription of MDR1, but up-regulate the expression of Bax. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell growth | Inhibition | hsa05200 | ||
| In Vitro Model | ECA-109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 |
| Experiment for Molecule Alteration |
RT-PCR; Northern blotting analysis | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | Down-regulation of miR-296 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs on esophageal cancer cells, and might promote ADR-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of ADR. Down-regulation of miR-296 could significantly decrease the expression of P-glycoprotein, Bcl-2, and the transcription of MDR1, but up-regulate the expression of Bax. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell growth | Inhibition | hsa05200 | ||
| In Vitro Model | ECA-109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 |
| Experiment for Molecule Alteration |
RT-PCR; Northern blotting analysis | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | Down-regulation of miR-296 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs on esophageal cancer cells, and might promote ADR-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of ADR. Down-regulation of miR-296 could significantly decrease the expression of P-glycoprotein, Bcl-2, and the transcription of MDR1, but up-regulate the expression of Bax. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [1] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Sunitinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
Response evaluation criteria in solid tumors assay | |||
| Mechanism Description | The patients with decrease in miR-296 at 4 weeks may reflect a more aggressive tumor phenotype with increased metastasis and tumor cell invasiveness. The loss of miR-296 may be one of the mechanisms for primary resistance of colorectal cancer to chemotherapy. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell growth | Inhibition | hsa05200 | ||
| In Vitro Model | ECA-109 cells | Esophagus | Homo sapiens (Human) | CVCL_6898 |
| Experiment for Molecule Alteration |
RT-PCR; Northern blotting analysis | |||
| Experiment for Drug Resistance |
WST-1 assay | |||
| Mechanism Description | Down-regulation of miR-296 could confer sensitivity of both P-glycoprotein-related and P-glycoprotein-nonrelated drugs on esophageal cancer cells, and might promote ADR-induced apoptosis, accompanied by increased accumulation and decreased releasing amount of ADR. Down-regulation of miR-296 could significantly decrease the expression of P-glycoprotein, Bcl-2, and the transcription of MDR1, but up-regulate the expression of Bax. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
