Molecule Information

General Information of the Molecule (ID: Mol01461)

• Name: hsa-mir-301a ,Homo sapiens
• Synonyms: microRNA 301a
• Molecule Type: Precursor miRNA
• Gene Name: MIR301A
• Gene ID: 407027
• Location: chr17:59151136-59151221[-]
• Sequence:
  ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAGUGCAAUA
  GUAUUGUCAAAGCAUCUGAAAGCAGG
• Ensembl ID: ENSG00000207996
• HGNC ID: HGNC:31622
• Precursor Accession: MI0000745

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [ICD-11: 2C30.0] [2]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SkMEL1 cells; Skin; Homo sapiens (Human); CVCL_0068
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• Experiment for Molecule Alteration: Luciferase reporter assay; qRT-PCR; Western blot assays
• Experiment for Drug Resistance: MTT assay; Colony formation assay; Flow cytometry assay; In vitro chemosensitivity assay
• Mechanism Description: We showed that the expression of miR-301a was significantly upregulated in MM tissues, and upregulation of miR-301a correlated with metastasis and poor prognosis of MM patients. Transfection of miR-301a/inhibitor significantly inhibited growth, colony formation, migration, invasion and enhanced apoptosis and chemosensitivity in MM cells, while transfection of miR-301a/mimic could induce the inverse effects on phenotypes of MM cells. Luciferase reporter, qRT-PCR and Western blot assays showed that phosphatase and tensin homolog (PTEN) was a direct and functional target of miR-301a. It was also observed that the Akt and FAK signaling pathways were involved in miR-301/PTEN-promoting MM progression.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [1]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Global microRNA profiling was performed on docetaxel-resistant and sensitive cell lines to identify candidate circulating microRNA biomarkers. Custom Taqman Array MicroRNA cards were used to measure the levels of 46 candidate microRNAs in plasma/serum samples, collected before and after docetaxel treatment, from 97 CRPC patients. Expression of hsa-mir-301a is increased.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [3]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AMPKalpha1/HMGCR; Regulation; N.A.
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: MG-63 cells; Bone; Homo sapiens (Human); CVCL_0426
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: In this study, we found that doxorubicin induced time-dependent expression of miR-301a in OS cells. Meantime, doxorubicin promoted HMGCR expression and inhibited AMPKalpha1 expression, which was further facilitated by miR-301a overexpression. Luciferase reporter assay identified AMPKalpha1 as direct target gene of miR-301a. Notably, miR-301a reduced doxorubicin-induced cell apoptosis whereas anti-miR-301a enhanced apoptosis in OS cells, suggesting that up-regulation of miR-301a contributed to chemoresistance of OS cells.

Erlotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [4]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Erlotinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/beta catenin; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: High-throughput miRNA analysis
• Experiment for Drug Resistance: Sulforhodamine-B assay
• Mechanism Description: Expression of 13 miRNA genes predicts response to EGFR inhibition in cancer cell lines and tumours, and discriminates primary from metastatic tumours. Signature genes target proteins that are enriched for epithelial-to-mesenchymal transition (EMT) genes. Epithelial-to-mesenchymal transition predicts EGFR inhibitor resistance and metastatic behaviour. The EMT transcription factor, ZEB1, shows altered expression in erlotinib-sensitive NSCLC and PDAC, where many signature miRNA genes are upregulated. Ectopic expression of mir-200c alters expression of EMT proteins, sensitivity to erlotinib, and migration in lung cells. Treatment with TGFbeta1 changes expression of signature miRNA and EMT proteins and modulates migration in lung cells.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [5]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: HPAF-II cells; Pancreatic; Homo sapiens (Human); CVCL_0313
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vitro Model: HEK 293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• Experiment for Molecule Alteration: RT-PCR; Western blot
• Experiment for Drug Resistance: Cell viability assay; Apoptosis assay
• Mechanism Description: Here, we showed that miR-301a was upregulated in a NF-kappaB independent manner and promoted gemcitabine resistance under hypoxic conditions in vitro.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] [6]

• Resistant Disease: Gastrointestinal stromal tumor [ICD-11: 2B5B.1]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: GIST882 cells; Gastric; Homo sapiens (Human); CVCL_7044
• In Vitro Model: GIST48 cells; Gastric; Homo sapiens (Human); CVCL_7041
• In Vivo Model: GIST patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR; Western blot
• Experiment for Drug Resistance: Cytotoxicity assay
• Mechanism Description: Functionally, miR-125a-5p expression modulated imatinib sensitivity in GIST882 cells with a homozygous KIT mutation but not in GIST48 cells with double KIT mutations. Overexpression of miR-125a-5p suppressed PTPN18 expression, and silencing of PTPN18 expression increased cell viability in GIST882 cells upon imatinib treatment.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: Characterization of LY3023414, a Novel PI3K/mTOR Dual Inhibitor Eliciting Transient Target Modulation to Impede Tumor GrowthMol Cancer Ther. 2016 Oct;15(10):2344-2356. doi: 10.1158/1535-7163.MCT-15-0996. Epub 2016 Jul 20.
• Ref 3: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 4: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 5: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 6: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.