Molecule Information
General Information of the Molecule (ID: Mol01452)
Name |
hsa-mir-1
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 1-1
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR1-1
|
||||
Gene ID | |||||
Location |
chr20:62554306-62554376[+]
|
||||
Sequence |
UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAG
UAUGUAUCUCA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-1 enhanced DDP sensitivity of DDP resistant NSCLC cells by downregulating ATG3. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR-1 reverses multidrug resistance in gastric cancer cells via downregulation of sorcin through promoting the accumulation of intracellular drugs and apoptosis of cells. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Esophageal squamous cell carcinoma | [3] | |||
Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
Sensitive Drug | Gefitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
PI3K/AKT/survivin signaling pathway | Inhibition | hsa04151 | ||
In Vitro Model | TE-1 cells | Esophagus | Homo sapiens (Human) | CVCL_1759 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | Exogenous expression of miR 1 inhibited growth, arrested cell cycle in the G1 phase and increased apoptosis in ESCC cells, whereas it decreased PIk3CA protein expression levels. Furthermore, overexpression of miR 1 increased the sensitivity of ESCC cells to the anticancer drug, gefitinib. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Vincristine | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | miR-1 reverses multidrug resistance in gastric cancer cells via downregulation of sorcin through promoting the accumulation of intracellular drugs and apoptosis of cells. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.