General Information of the Molecule (ID: Mol01452)
Name
hsa-mir-1 ,Homo sapiens
Synonyms
microRNA 1-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR1-1
Gene ID
406904
Location
chr20:62554306-62554376[+]
Sequence
UGGGAAACAUACUUCUUUAUAUGCCCAUAUGGACCUGCUAAGCUAUGGAAUGUAAAGAAG
UAUGUAUCUCA
    Click to Show/Hide
Ensembl ID
ENSG00000199017
HGNC ID
HGNC:31499
Precursor Accession
MI0000651
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-1 enhanced DDP sensitivity of DDP resistant NSCLC cells by downregulating ATG3.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-1 reverses multidrug resistance in gastric cancer cells via downregulation of sorcin through promoting the accumulation of intracellular drugs and apoptosis of cells.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [3]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
PI3K/AKT/survivin signaling pathway Inhibition hsa04151
In Vitro Model TE-1 cells Esophagus Homo sapiens (Human) CVCL_1759
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Exogenous expression of miR 1 inhibited growth, arrested cell cycle in the G1 phase and increased apoptosis in ESCC cells, whereas it decreased PIk3CA protein expression levels. Furthermore, overexpression of miR 1 increased the sensitivity of ESCC cells to the anticancer drug, gefitinib.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Vincristine
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-1 reverses multidrug resistance in gastric cancer cells via downregulation of sorcin through promoting the accumulation of intracellular drugs and apoptosis of cells.
References
Ref 1 MicroRNA-1 overexpression increases chemosensitivity of non-small cell lung cancer cells by inhibiting autophagy related 3-mediated autophagy. Cell Biol Int. 2018 Sep;42(9):1240-1249. doi: 10.1002/cbin.10995. Epub 2018 Jun 15.
Ref 2 miR 1 reverses multidrug resistance in gastric cancer cells via downregulation of sorcin through promoting the accumulation of intracellular drugs and apoptosis of cells. Int J Oncol. 2019 Aug;55(2):451-461. doi: 10.3892/ijo.2019.4831. Epub 2019 Jun 25.
Ref 3 MicroRNA-1 inhibits tumorigenicity of esophageal squamous cell carcinoma and enhances sensitivity to gefitinib. Oncol Lett. 2018 Jan;15(1):963-971. doi: 10.3892/ol.2017.7378. Epub 2017 Nov 9.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.