Molecule Information
General Information of the Molecule (ID: Mol01448)
| Name |
hsa-mir-195
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 195
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR195
|
||||
| Gene ID | |||||
| Location |
chr17:7017615-7017701[-]
|
||||
| Sequence |
AGCUUCCCUGGCUCUAGCAGCACAGAAAUAUUGGCACAGGGAAGCGAGUCUGCCAAUAUU
GGCUGUGCUGCUCCAGGCAGGGUGGUG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Epidermoid carcinoma [ICD-11: 2C31.Z] | [1] | |||
| Sensitive Disease | Epidermoid carcinoma [ICD-11: 2C31.Z] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | KB-3-1 cells | Lung | Homo sapiens (Human) | CVCL_2088 |
| KB-CP.5 cells | Lung | Homo sapiens (Human) | CVCL_IP04 | |
| KB-CP20 cells | Lung | Homo sapiens (Human) | CVCL_IP06 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prostate cancer [ICD-11: 2C82.0] | [2] | |||
| Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell colony | Activation | hsa05200 | ||
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-195 improved the sensitivity of resistant PC cells to DOC by suppressing CLU. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| PI3K/PTEN/AKT signaling pathway | Regulation | N.A. | ||
| RAS/RAF/MEK/ERK signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| HBL-100 cells | Breast | Homo sapiens (Human) | CVCL_4362 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Induction of miR-195 expression promoted tumor cell apoptosis and inhibited breast cancer cell viability, but induced the sensitivity of breast cancer cells to Adriamycin treatment and was associated with inhibition of Raf-1 expression in breast cancer cells. | |||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [4] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Suppression of miR-195 leads to elevation of its direct target gene BCL2L2 expression therefore makes the human colon cancer cells more resistant to Dox. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [5] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
| Mechanism Description | Inhibition of miR195 sensitized resistant cells to 5-FU by downregulating WEE1 and CHk1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [6] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
| Bel-7402/5-Fu cells | Liver | Homo sapiens (Human) | CVCL_5493 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-195 antisense oligonucleotide induced drug resistance in BEL-7402/5-FU cells. miR-195 overexpression repressed Bcl-w protein level. miR-195, one of the down-regulated miRNAs in BEL-7402/5-FU cells, was demonstrated to play a role in the development of drug resistance in hepatocellular carcinoma cells by targeting the antiapoptotic gene, Bcl-w. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [7] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | J82 cells | Bladder | Homo sapiens (Human) | CVCL_0359 |
| UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
| RT4 cells | Bladder | Homo sapiens (Human) | CVCL_0036 | |
| RT112 cells | Bladder | Homo sapiens (Human) | CVCL_1670 | |
| Experiment for Molecule Alteration |
Western blot; Microarray Analysis; qRT-PCR | |||
| Experiment for Drug Resistance |
Proliferation Assay | |||
| Mechanism Description | Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] | [7] | |||
| Resistant Disease | Gastrointestinal stromal tumor [ICD-11: 2B5B.1] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | GIST patients and GIST patients who developed imatinib resistance | Homo sapiens | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Mechanism Description | Compared with the primary GISTs, the expression levels of five genes (hsa-miR-15a, hsa-miR-16, hsa-miR-195, hsa-miR-335, and hsa-miR-151-5p) were upregulated and the levels of eight genes (hsa-miR-1280, hsa-miR-140-5p, hsa-miR-320a, hsa-miR-135b, hsa-miR-664*, hsa-miR-483-5p, hsa-miR-140-3p, and hsa-miR-574-3p) were downregulated in imatinib-resistant GISTs | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | [8] | |||
| Resistant Disease | Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | |||
| Resistant Drug | Methotrexate | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Cytotoxic Assay | |||
| Mechanism Description | MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [9] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | miR-195-5p signalling | Regulation | N.A. | |
| In Vitro Model | AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| In Vivo Model | GC tissues model | Homo sapiens | ||
| Experiment for Molecule Alteration |
qRT-PCR; Western blot; Luciferase assay | |||
| Experiment for Drug Resistance |
Cell viability assay; EdU incorporation assay; Apoptosis analysis | |||
| Mechanism Description | Taken together, our findings demonstrated that HOTAIR regulates ABCG2 induced resistance of GC to oxaliplatin through miR-195-5p signalling and illustrate the great potential of developing new therapeutic targets for GC patients. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [10] | |||
| Resistant Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 |
| Caski cells | Uterus | Homo sapiens (Human) | CVCL_1100 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometric analysis; CCK8 assay | |||
| Mechanism Description | LncRNA PVT1 epigenetically silences miR195 and modulates EMT and chemoresistance in cervical cancer cells. PVT1 could decrease miR195 expression via enhancing histone H3k27me3 in the miR195 promoter region and also via direct sponging of miR195. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioma [ICD-11: 2A00.1] | [11] | |||
| Resistant Disease | Glioma [ICD-11: 2A00.1] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | U251-MG cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Hsa-miR-195 could negatively regulate the expression of CCNE1 in glioma and microRNA-195 reverses the resistance to temozolomide through targeting cyclin E1 in glioma cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
