General Information of the Molecule (ID: Mol01448)
Name
hsa-mir-195 ,Homo sapiens
Synonyms
microRNA 195
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR195
Gene ID
406971
Location
chr17:7017615-7017701[-]
Sequence
AGCUUCCCUGGCUCUAGCAGCACAGAAAUAUUGGCACAGGGAAGCGAGUCUGCCAAUAUU
GGCUGUGCUGCUCCAGGCAGGGUGGUG
    Click to Show/Hide
Ensembl ID
ENSG00000284112
HGNC ID
HGNC:31566
Precursor Accession
MI0000489
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Epidermoid carcinoma [ICD-11: 2C31.Z] [1]
Sensitive Disease Epidermoid carcinoma [ICD-11: 2C31.Z]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model KB-3-1 cells Lung Homo sapiens (Human) CVCL_2088
KB-CP.5 cells Lung Homo sapiens (Human) CVCL_IP04
KB-CP20 cells Lung Homo sapiens (Human) CVCL_IP06
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [2]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
Resistant Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell colony Activation hsa05200
Cell viability Activation hsa05200
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-195 improved the sensitivity of resistant PC cells to DOC by suppressing CLU.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
PI3K/PTEN/AKT signaling pathway Regulation N.A.
RAS/RAF/MEK/ERK signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
HBL-100 cells Breast Homo sapiens (Human) CVCL_4362
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Induction of miR-195 expression promoted tumor cell apoptosis and inhibited breast cancer cell viability, but induced the sensitivity of breast cancer cells to Adriamycin treatment and was associated with inhibition of Raf-1 expression in breast cancer cells.
Disease Class: Colon cancer [ICD-11: 2B90.1] [4]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
LOVO cells Colon Homo sapiens (Human) CVCL_0399
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Suppression of miR-195 leads to elevation of its direct target gene BCL2L2 expression therefore makes the human colon cancer cells more resistant to Dox.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [5]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometric analysis
Mechanism Description Inhibition of miR195 sensitized resistant cells to 5-FU by downregulating WEE1 and CHk1.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [6]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
Bel-7402/5-Fu cells Liver Homo sapiens (Human) CVCL_5493
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-195 antisense oligonucleotide induced drug resistance in BEL-7402/5-FU cells. miR-195 overexpression repressed Bcl-w protein level. miR-195, one of the down-regulated miRNAs in BEL-7402/5-FU cells, was demonstrated to play a role in the development of drug resistance in hepatocellular carcinoma cells by targeting the antiapoptotic gene, Bcl-w.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Cervical cancer [ICD-11: 2C77.0] [7]
Resistant Disease Cervical cancer [ICD-11: 2C77.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
Caski cells Uterus Homo sapiens (Human) CVCL_1100
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometric analysis; CCK8 assay
Mechanism Description LncRNA PVT1 epigenetically silences miR195 and modulates EMT and chemoresistance in cervical cancer cells. PVT1 could decrease miR195 expression via enhancing histone H3k27me3 in the miR195 promoter region and also via direct sponging of miR195.
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [8]
Resistant Disease Glioma [ICD-11: 2A00.1]
Resistant Drug Temozolomide
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model U251-MG cells Brain Homo sapiens (Human) CVCL_0021
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Hsa-miR-195 could negatively regulate the expression of CCNE1 in glioma and microRNA-195 reverses the resistance to temozolomide through targeting cyclin E1 in glioma cells.
References
Ref 1 Cisplatin sensitivity mediated by WEE1 and CHK1 is mediated by miR-155 and the miR-15 family. Cancer Res. 2012 Nov 15;72(22):5945-55. doi: 10.1158/0008-5472.CAN-12-1400. Epub 2012 Aug 31.
Ref 2 MicroRNA-195 regulates docetaxel resistance by targeting clusterin in prostate cancer. Biomed Pharmacother. 2018 Mar;99:445-450. doi: 10.1016/j.biopha.2018.01.088. Epub 2018 Feb 20.
Ref 3 Upregulation of miR-195 increases the sensitivity of breast cancer cells to Adriamycin treatment through inhibition of Raf-1. Oncol Rep. 2013 Aug;30(2):877-89. doi: 10.3892/or.2013.2532. Epub 2013 Jun 11.
Ref 4 MicroRNA-195 chemosensitizes colon cancer cells to the chemotherapeutic drug doxorubicin by targeting the first binding site of BCL2L2 mRNA. J Cell Physiol. 2015 Mar;230(3):535-45. doi: 10.1002/jcp.24366.
Ref 5 MicroRNA-195 desensitizes HCT116 human colon cancer cells to 5-fluorouracil. Cancer Lett. 2018 Jan 1;412:264-271. doi: 10.1016/j.canlet.2017.10.022. Epub 2017 Nov 5.
Ref 6 miRNA-195 sensitizes human hepatocellular carcinoma cells to 5-FU by targeting BCL-w. Oncol Rep. 2012 Jan;27(1):250-7. doi: 10.3892/or.2011.1472. Epub 2011 Sep 22.
Ref 7 LncRNA PVT1 epigenetically silences miR-195 and modulates EMT and chemoresistance in cervical cancer cells. J Drug Target. 2017 Aug;25(7):637-644. doi: 10.1080/1061186X.2017.1307379. Epub 2017 Apr 3.
Ref 8 MicroRNA-195 reverses the resistance to temozolomide through targeting cyclin E1 in glioma cells. Anticancer Drugs. 2019 Jan;30(1):81-88. doi: 10.1097/CAD.0000000000000700.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.