Molecule Information
General Information of the Molecule (ID: Mol01446)
Name |
hsa-mir-193a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 193a
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR193A
|
||||
Gene ID | |||||
Location |
chr17:31559996-31560083[+]
|
||||
Sequence |
CGAGGAUGGGAGCUGAGGGCUGGGUCUUUGCGGGCGAGAUGAGGGUGUCGGAUCAACUGG
CCUACAAAGUCCCAGUUCUCGGCCCCCG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Multiple myeloma | [1] | |||
Sensitive Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
Sensitive Drug | Dexamethasone | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | miR193a/MCL1 signaling pathway | Activation | hsa05206 | |
In Vitro Model | U266 cells | Bone marrow | Homo sapiens (Human) | CVCL_0566 |
ANBL6 cells | Peripheral blood | Homo sapiens (Human) | CVCL_5425 | |
JJN-3 cells | Bone marrow | Homo sapiens (Human) | CVCL_2078 | |
MM1R cells | Peripheral blood | Homo sapiens (Human) | CVCL_8794 | |
MM1S cells | Peripheral blood | Homo sapiens (Human) | CVCL_8792 | |
OPM-2 cells | Peripheral blood | Homo sapiens (Human) | CVCL_1625 | |
RPMI-8226 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0014 | |
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
Mechanism Description | LncRNA NEAT1 promotes dexamethasone resistance in multiple myeloma by targeting miR193a/MCL1 pathway. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.