Molecule Information

General Information of the Molecule (ID: Mol01446)

• Name: hsa-mir-193a ,Homo sapiens
• Synonyms: microRNA 193a
• Molecule Type: Precursor miRNA
• Gene Name: MIR193A
• Gene ID: 406968
• Location: chr17:31559996-31560083[+]
• Sequence:
  CGAGGAUGGGAGCUGAGGGCUGGGUCUUUGCGGGCGAGAUGAGGGUGUCGGAUCAACUGG
  CCUACAAAGUCCCAGUUCUCGGCCCCCG
• Ensembl ID: ENSG00000207614
• HGNC ID: HGNC:31563
• Precursor Accession: MI0000487

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Dexamethasone

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Multiple myeloma [1]

• Sensitive Disease: Multiple myeloma [ICD-11: 2A83.0]
• Sensitive Drug: Dexamethasone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: miR193a/MCL1 signaling pathway; Activation; hsa05206
• In Vitro Model: U266 cells; Bone marrow; Homo sapiens (Human); CVCL_0566
• In Vitro Model: ANBL6 cells; Peripheral blood; Homo sapiens (Human); CVCL_5425
• In Vitro Model: JJN-3 cells; Bone marrow; Homo sapiens (Human); CVCL_2078
• In Vitro Model: MM1R cells; Peripheral blood; Homo sapiens (Human); CVCL_8794
• In Vitro Model: MM1S cells; Peripheral blood; Homo sapiens (Human); CVCL_8792
• In Vitro Model: OPM-2 cells; Peripheral blood; Homo sapiens (Human); CVCL_1625
• In Vitro Model: RPMI-8226 cells; Peripheral blood; Homo sapiens (Human); CVCL_0014
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: LncRNA NEAT1 promotes dexamethasone resistance in multiple myeloma by targeting miR193a/MCL1 pathway.

References

• Ref 1: LncRNA NEAT1 promotes dexamethasone resistance in multiple myeloma by targeting miR-193a/MCL1 pathway. J Biochem Mol Toxicol. 2018 Jan;32(1). doi: 10.1002/jbt.22008. Epub 2017 Dec 4.