Molecule Information
General Information of the Molecule (ID: Mol01444)
Name |
hsa-mir-185
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 185
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR185
|
||||
Gene ID | |||||
Location |
chr22:20033139-20033220[+]
|
||||
Sequence |
AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCU
UUCCUCUGGUCCUUCCCUCCCA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Trypan blue exclusion assay; Tunel assay | |||
Mechanism Description | Restoration of miR-185 alone can inhibit gastric cancer tumor growth. Moreover, combination therapy using enforced miR-185 expression and lower dose chemotherapeutic drugs had an effective therapeutic activity against large established tumors, with decreased host toxicity. miR-185 increases the chemosensitivity of gastric cancer cells in vitro and in vivo. It exerts tumor-suppressing function through negatively regulating ARC. Besides, miR-185 upregulation in response to cisplatin or doxorubicin treatment in gastric cancer cells is dependent on RUNX3 transcriptional activity. | |||
Disease Class: Ovarian cancer | [2] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
A2780/DDP cells | Ovary | Homo sapiens (Human) | CVCL_D619 | |
In Vivo Model | CD-1/CD-1 nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-152 and miR-185 were involved in cisplatin resistance, miR-152 and miR-185 increased cisplatin sensitivity mainly through the direct downregulation of DNMT1. DNMT1 is the most abundant DNA methyltransferase in mammalian cells and the key enzyme for the maintenance of hemimethylated DNA during DNA replication and de novo methylation during somatic cell development and differentiation. DNMT1 expression is also upregulated in many malignancies. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Trypan blue exclusion assay; Tunel assay | |||
Mechanism Description | Restoration of miR-185 alone can inhibit gastric cancer tumor growth. Moreover, combination therapy using enforced miR-185 expression and lower dose chemotherapeutic drugs had an effective therapeutic activity against large established tumors, with decreased host toxicity. miR-185 increases the chemosensitivity of gastric cancer cells in vitro and in vivo. It exerts tumor-suppressing function through negatively regulating ARC. Besides, miR-185 upregulation in response to cisplatin or doxorubicin treatment in gastric cancer cells is dependent on RUNX3 transcriptional activity. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.