General Information of the Molecule (ID: Mol01444)
Name
hsa-mir-185 ,Homo sapiens
Synonyms
microRNA 185
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR185
Gene ID
406961
Location
chr22:20033139-20033220[+]
Sequence
AGGGGGCGAGGGAUUGGAGAGAAAGGCAGUUCCUGAUGGUCCCCUCCCCAGGGGCUGGCU
UUCCUCUGGUCCUUCCCUCCCA
    Click to Show/Hide
Ensembl ID
ENSG00000208023
HGNC ID
HGNC:31556
Precursor Accession
MI0000482
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
AGS cells Gastric Homo sapiens (Human) CVCL_0139
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Trypan blue exclusion assay; Tunel assay
Mechanism Description Restoration of miR-185 alone can inhibit gastric cancer tumor growth. Moreover, combination therapy using enforced miR-185 expression and lower dose chemotherapeutic drugs had an effective therapeutic activity against large established tumors, with decreased host toxicity. miR-185 increases the chemosensitivity of gastric cancer cells in vitro and in vivo. It exerts tumor-suppressing function through negatively regulating ARC. Besides, miR-185 upregulation in response to cisplatin or doxorubicin treatment in gastric cancer cells is dependent on RUNX3 transcriptional activity.
Disease Class: Ovarian cancer [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
A2780/DDP cells Ovary Homo sapiens (Human) CVCL_D619
In Vivo Model CD-1/CD-1 nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-152 and miR-185 were involved in cisplatin resistance, miR-152 and miR-185 increased cisplatin sensitivity mainly through the direct downregulation of DNMT1. DNMT1 is the most abundant DNA methyltransferase in mammalian cells and the key enzyme for the maintenance of hemimethylated DNA during DNA replication and de novo methylation during somatic cell development and differentiation. DNMT1 expression is also upregulated in many malignancies.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
AGS cells Gastric Homo sapiens (Human) CVCL_0139
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
NCI-N87 cells Gastric Homo sapiens (Human) CVCL_1603
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Trypan blue exclusion assay; Tunel assay
Mechanism Description Restoration of miR-185 alone can inhibit gastric cancer tumor growth. Moreover, combination therapy using enforced miR-185 expression and lower dose chemotherapeutic drugs had an effective therapeutic activity against large established tumors, with decreased host toxicity. miR-185 increases the chemosensitivity of gastric cancer cells in vitro and in vivo. It exerts tumor-suppressing function through negatively regulating ARC. Besides, miR-185 upregulation in response to cisplatin or doxorubicin treatment in gastric cancer cells is dependent on RUNX3 transcriptional activity.
References
Ref 1 MicroRNA-185 regulates chemotherapeutic sensitivity in gastric cancer by targeting apoptosis repressor with caspase recruitment domain. Cell Death Dis. 2014 Apr 24;5(4):e1197. doi: 10.1038/cddis.2014.148.
Ref 2 MiR-152 and miR-185 co-contribute to ovarian cancer cells cisplatin sensitivity by targeting DNMT1 directly: a novel epigenetic therapy independent of decitabine. Oncogene. 2014 Jan 16;33(3):378-86. doi: 10.1038/onc.2012.575. Epub 2013 Jan 14.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.