Molecule Information
General Information of the Molecule (ID: Mol01437)
| Name |
hsa-mir-126
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 126
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR126
|
||||
| Gene ID | |||||
| Location |
chr9:136670602-136670686[+]
|
||||
| Sequence |
CGCUGGCGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGU
GAGUAAUAAUGCGCCGUCCACGGCA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
12 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [2] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Bleomycin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Upregulation of miR-126 inhibited cervical cancer cell proliferation and enhanced the sensitivity to BLM. Thus, miR-126 may represent a novel approach to cervical cancer treatment. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] | [3] | |||
| Resistant Disease | Prolactin-secreting adenoma [ICD-11: 2F37.Y] | |||
| Resistant Drug | Bromocriptine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | KHM-5M cells | Pleural effusion | Homo sapiens (Human) | CVCL_2975 |
| Experiment for Molecule Alteration |
Solexa sequencing assay; qRT-PCR | |||
| Experiment for Drug Resistance |
Clinical diagnostic evaluation | |||
| Mechanism Description | Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [4] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | PI3K/AKT/MRP1 signaling pathway | Activation | hsa04151 | |
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| BGC-823/DDP cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
| Experiment for Molecule Alteration |
qRT-PCR; Dual-luciferase reporter assay | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometric cell cycle assay; Annexin V-FITC Apoptosis assay | |||
| Mechanism Description | LncRNA HOTAIR promotes cisplatin resistance in gastric cancer by targeting miR126 to activate the PI3k/AkT/MRP1 genes. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] | [5] | |||
| Resistant Disease | Acute lymphocytic leukemia [ICD-11: 2B33.0] | |||
| Resistant Drug | Daunorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
RT-qPCR; RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry; MTT assay | |||
| Mechanism Description | Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001). | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [6] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
qRT-PCR; Western blot; Dual luciferase assay | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [7] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| SGC7901/ADR cells | Gastric | Homo sapiens (Human) | CVCL_VU57 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Caspase3/7 activity assay | |||
| Mechanism Description | microRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2. | |||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [8] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | PI3K/AKT signaling pathway | Inhibition | hsa04151 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | VEGF activates the downstream PI3k/Akt signaling pathway, which is a critical regulator of cellular growth, differentiation, and metabolism. miR-126 could overcome the resistance of NSCLC cells to antineoplastic drugs through inhibition of a VEGF-PI3k/Akt signaling pathway that resulted in the down-regulation of MRP1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | [9] | |||
| Resistant Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SW1990 cells | Pancreas | Homo sapiens (Human) | CVCL_1723 |
| SW1990 cells | Pancreas | Homo sapiens (Human) | CVCL_1723 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Mechanism Description | Differential gene expression between parental and gemcitabine-resistant pancreatic cancer cell. Consequently, compared with SW1990 cells, 28 microRNAs were upregulated and 28 microRNAs were decreased (fold change>=2) in SW1990/GEM cells. Then, the expression of some differential microRNAs was confirmed by Q-PCR assays. We found that miR-643, miR-1261, miR483-5p, miR-371a-5p, and miR-373-3p were upregulated and that the expression of miR-4455, miR-3676, miR-4650, miR4791, and miR-4644 was decreased in SW1990/GEM cells. Generally, the tendency of expression changes was consistent between microRNA-seq and Q-PCR results. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [10] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| 293T cells | Breast | Homo sapiens (Human) | CVCL_0063 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Over-expression of miR-126 in colon cancer cell was able to inhibit cell proliferation, promote cell apoptosis and reduce the invasive ability. miR-126 significantly enhanced the sensitivity of the colon cancer cell to chemotherapeutic drug. It has been shown that IRS1, SLC75A and TOM1 were the potential target genes of miR-126 in colon cancer. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [11] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | p53 signaling | Regulation | N.A. | |
| In Vitro Model | TOV21G cells | Ovary | Homo sapiens (Human) | CVCL_3613 |
| TOV112D cells | Ovary | Homo sapiens (Human) | CVCL_3612 | |
| C13 cells | Ovary | Homo sapiens (Human) | CVCL_0114 | |
| OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
| A2780CP cells | Ovary | Homo sapiens (Human) | CVCL_0135 | |
| A2780s cells | Ovary | Homo sapiens (Human) | CVCL_4863 | |
| IGROV1 cells | Ovary | Homo sapiens (Human) | CVCL_1304 | |
| OVCAR5 cells | Ovary | Homo sapiens (Human) | CVCL_1628 | |
| OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
| SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 | |
| Experiment for Molecule Alteration |
miRNA probe assay | |||
| Experiment for Drug Resistance |
Cell proliferation assays | |||
| Mechanism Description | MicroRNAs (miRNAs) are 19 to 25-nucleotide, non-coding, RNA transcripts, thought to be instrumental in controlling eukaryotic cell function via modulation of post-transcriptional activity of multiple target mRNA genes by repression of translation or regulation of mRNA degradation. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [12] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
| LCC9 cells | Breast | Homo sapiens (Human) | CVCL_DP52 | |
| Experiment for Molecule Alteration |
Microarray analyses; qPCR; RT-PCR; Western blot | |||
| Mechanism Description | Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [7] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| SGC7901/ADR cells | Gastric | Homo sapiens (Human) | CVCL_VU57 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Caspase3/7 activity assay | |||
| Mechanism Description | microRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2. | |||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [8] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | PI3K/AKT signaling pathway | Inhibition | hsa04151 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | VEGF activates the downstream PI3k/Akt signaling pathway, which is a critical regulator of cellular growth, differentiation, and metabolism. miR-126 could overcome the resistance of NSCLC cells to antineoplastic drugs through inhibition of a VEGF-PI3k/Akt signaling pathway that resulted in the down-regulation of MRP1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [13] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Epigallocatechin gallate | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| Experiment for Molecule Alteration |
Flow cytometry assay | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-126 sensitizes osteosarcoma cells to apoptosis induced by epigallocatechin-3-gallate. | |||
Clinical Trial Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [14] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | TRAIL | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR126 reverses drug resistance to TRAIL through inhibiting the expression of c-FLIP in cervical cancer miR126 promotes TRAIL-induced apoptosis in TRAIL-resistant cervical cancer cells and increases the sensitivity of Hela-TR and SiHa-TR to TNF-alphaand FasL. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [15] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Hydroxycamptothecin | |||
| Molecule Alteration | Expression | . |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| SGC-7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| Experiment for Molecule Alteration |
MiRNA microarray profiling, qRT-PCR | |||
| Experiment for Drug Resistance |
A sulforhodamine B (SRB) assay | |||
| Mechanism Description | MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
