Molecule Information

General Information of the Molecule (ID: Mol01437)

• Name: hsa-mir-126 ,Homo sapiens
• Synonyms: microRNA 126
• Molecule Type: Precursor miRNA
• Gene Name: MIR126
• Gene ID: 406913
• Location: chr9:136670602-136670686[+]
• Sequence:
  CGCUGGCGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGU
  GAGUAAUAAUGCGCCGUCCACGGCA
• Ensembl ID: ENSG00000199161
• HGNC ID: HGNC:31508
• Precursor Accession: MI0000471

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 12 drug(s) in total

Bleomycin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [2]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Bleomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Upregulation of miR-126 inhibited cervical cancer cell proliferation and enhanced the sensitivity to BLM. Thus, miR-126 may represent a novel approach to cervical cancer treatment.

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] [3]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: KHM-5M cells; Pleural effusion; Homo sapiens (Human); CVCL_2975
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: Clinical diagnostic evaluation
• Mechanism Description: Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [4]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT/MRP1 signaling pathway; Activation; hsa04151
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC-7901/DDP cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC-823/DDP cells; Gastric; Homo sapiens (Human); CVCL_3360
• Experiment for Molecule Alteration: qRT-PCR; Dual-luciferase reporter assay
• Experiment for Drug Resistance: CCK8 assay; Colony formation assay; Flow cytometric cell cycle assay; Annexin V-FITC Apoptosis assay
• Mechanism Description: LncRNA HOTAIR promotes cisplatin resistance in gastric cancer by targeting miR126 to activate the PI3k/AkT/MRP1 genes.

Daunorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [5]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR; RT-PCR
• Experiment for Drug Resistance: Flow cytometry; MTT assay
• Mechanism Description: Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [6]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Dual luciferase assay
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [7]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Caspase3/7 activity assay
• Mechanism Description: microRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2.

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [8]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: VEGF activates the downstream PI3k/Akt signaling pathway, which is a critical regulator of cellular growth, differentiation, and metabolism. miR-126 could overcome the resistance of NSCLC cells to antineoplastic drugs through inhibition of a VEGF-PI3k/Akt signaling pathway that resulted in the down-regulation of MRP1.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [9]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Differential gene expression between parental and gemcitabine-resistant pancreatic cancer cell. Consequently, compared with SW1990 cells, 28 microRNAs were upregulated and 28 microRNAs were decreased (fold change>=2) in SW1990/GEM cells. Then, the expression of some differential microRNAs was confirmed by Q-PCR assays. We found that miR-643, miR-1261, miR483-5p, miR-371a-5p, and miR-373-3p were upregulated and that the expression of miR-4455, miR-3676, miR-4650, miR4791, and miR-4644 was decreased in SW1990/GEM cells. Generally, the tendency of expression changes was consistent between microRNA-seq and Q-PCR results.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [10]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Over-expression of miR-126 in colon cancer cell was able to inhibit cell proliferation, promote cell apoptosis and reduce the invasive ability. miR-126 significantly enhanced the sensitivity of the colon cancer cell to chemotherapeutic drug. It has been shown that IRS1, SLC75A and TOM1 were the potential target genes of miR-126 in colon cancer.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [11]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: p53 signaling; Regulation; N.A.
• In Vitro Model: TOV21G cells; Ovary; Homo sapiens (Human); CVCL_3613
• In Vitro Model: TOV112D cells; Ovary; Homo sapiens (Human); CVCL_3612
• In Vitro Model: C13 cells; Ovary; Homo sapiens (Human); CVCL_0114
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vitro Model: A2780CP cells; Ovary; Homo sapiens (Human); CVCL_0135
• In Vitro Model: A2780s cells; Ovary; Homo sapiens (Human); CVCL_4863
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• In Vitro Model: OVCAR5 cells; Ovary; Homo sapiens (Human); CVCL_1628
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: miRNA probe assay
• Experiment for Drug Resistance: Cell proliferation assays
• Mechanism Description: MicroRNAs (miRNAs) are 19 to 25-nucleotide, non-coding, RNA transcripts, thought to be instrumental in controlling eukaryotic cell function via modulation of post-transcriptional activity of multiple target mRNA genes by repression of translation or regulation of mRNA degradation.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [12]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [7]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• In Vitro Model: SGC7901/ADR cells; Gastric; Homo sapiens (Human); CVCL_VU57
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Caspase3/7 activity assay
• Mechanism Description: microRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2.

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [8]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: VEGF activates the downstream PI3k/Akt signaling pathway, which is a critical regulator of cellular growth, differentiation, and metabolism. miR-126 could overcome the resistance of NSCLC cells to antineoplastic drugs through inhibition of a VEGF-PI3k/Akt signaling pathway that resulted in the down-regulation of MRP1.

Epigallocatechin gallate

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [13]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Epigallocatechin gallate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: Flow cytometry assay
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Overexpression of miR-126 sensitizes osteosarcoma cells to apoptosis induced by epigallocatechin-3-gallate.

Clinical Trial Drug(s) 2 drug(s) in total

TRAIL

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [14]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: TRAIL
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR126 reverses drug resistance to TRAIL through inhibiting the expression of c-FLIP in cervical cancer miR126 promotes TRAIL-induced apoptosis in TRAIL-resistant cervical cancer cells and increases the sensitivity of Hela-TR and SiHa-TR to TNF-alphaand FasL.

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [15]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; .
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

References

• Ref 1: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 2: miR-126 Suppresses the proliferation of cervical cancer cells and alters cell sensitivity to the chemotherapeutic drug bleomycin. Asian Pac J Cancer Prev. 2014 Jan;14(11):6569-72. doi: 10.7314/apjcp.2013.14.11.6569.
• Ref 3: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 4: LncRNA HOTAIR promotes cisplatin resistance in gastric cancer by targeting miR-126 to activate the PI3K/AKT/MRP1 genes. Tumour Biol. 2016 Nov 30. doi: 10.1007/s13277-016-5448-5. Online ahead of print.
• Ref 5: BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
• Ref 6: miRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat. 2012 Jan;131(2):445-54. doi: 10.1007/s10549-011-1424-3. Epub 2011 Mar 12.
• Ref 7: MicroRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2. Biochem Biophys Res Commun. 2016 Oct 7;479(1):91-6. doi: 10.1016/j.bbrc.2016.09.040. Epub 2016 Sep 10.
• Ref 8: miR-126 enhances the sensitivity of non-small cell lung cancer cells to anticancer agents by targeting vascular endothelial growth factor A. Acta Biochim Biophys Sin (Shanghai). 2012 Jun;44(6):519-26. doi: 10.1093/abbs/gms026. Epub 2012 Apr 16.
• Ref 9: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 10: [miR-126 inhibits colon cancer proliferation and invasion through targeting IRS1, SLC7A5 and TOM1 gene]. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2013 Aug;38(8):809-17. doi: 10.3969/j.issn.1672-7347.2013.08.009.
• Ref 11: Sequential development of mutant clones in an imatinib resistant chronic myeloid leukaemia patient following sequential treatment with multiple tyrosine kinase inhibitors: an emerging problem . Cancer Chemother Pharmacol. 2009 Jun;64(1):195-7. doi: 10.1007/s00280-008-0905-5. Epub 2009 Jan 21.
• Ref 12: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 13: Overexpression of miR-126 sensitizes osteosarcoma cells to apoptosis induced by epigallocatechin-3-gallate. World J Surg Oncol. 2014 Dec 16;12:383. doi: 10.1186/1477-7819-12-383.
• Ref 14: MiR-126 reverses drug resistance to TRAIL through inhibiting the expression of c-FLIP in cervical cancer. Gene. 2017 Sep 5;627:420-427. doi: 10.1016/j.gene.2017.06.055. Epub 2017 Jun 29.
• Ref 15: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.