Molecule Information
General Information of the Molecule (ID: Mol01437)
Name |
hsa-mir-126
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 126
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR126
|
||||
Gene ID | |||||
Location |
chr9:136670602-136670686[+]
|
||||
Sequence |
CGCUGGCGACGGGACAUUAUUACUUUUGGUACGCGCUGUGACACUUCAAACUCGUACCGU
GAGUAAUAAUGCGCCGUCCACGGCA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Cervical cancer | [1] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Bleomycin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
In Vitro Model | Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Upregulation of miR-126 inhibited cervical cancer cell proliferation and enhanced the sensitivity to BLM. Thus, miR-126 may represent a novel approach to cervical cancer treatment. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prolactin-secreting adenoma | [2] | |||
Resistant Disease | Prolactin-secreting adenoma [ICD-11: 2F37.Y] | |||
Resistant Drug | Bromocriptine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | KHM-5M cells | Pleural effusion | Homo sapiens (Human) | CVCL_2975 |
Experiment for Molecule Alteration |
Solexa sequencing assay; qRT-PCR | |||
Experiment for Drug Resistance |
Clinical diagnostic evaluation | |||
Mechanism Description | Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [3] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | PI3K/AKT/MRP1 signaling pathway | Activation | hsa04151 | |
In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
BGC-823/DDP cells | Gastric | Homo sapiens (Human) | CVCL_3360 | |
Experiment for Molecule Alteration |
qRT-PCR; Dual-luciferase reporter assay | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometric cell cycle assay; Annexin V-FITC Apoptosis assay | |||
Mechanism Description | LncRNA HOTAIR promotes cisplatin resistance in gastric cancer by targeting miR126 to activate the PI3k/AkT/MRP1 genes. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [4] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
SGC7901/ADR cells | Gastric | Homo sapiens (Human) | CVCL_VU57 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Caspase3/7 activity assay | |||
Mechanism Description | microRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2. | |||
Disease Class: Non-small cell lung cancer | [5] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | PI3K/AKT signaling pathway | Inhibition | hsa04151 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | VEGF activates the downstream PI3k/Akt signaling pathway, which is a critical regulator of cellular growth, differentiation, and metabolism. miR-126 could overcome the resistance of NSCLC cells to antineoplastic drugs through inhibition of a VEGF-PI3k/Akt signaling pathway that resulted in the down-regulation of MRP1. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colon cancer | [6] | |||
Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
293T cells | Breast | Homo sapiens (Human) | CVCL_0063 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Over-expression of miR-126 in colon cancer cell was able to inhibit cell proliferation, promote cell apoptosis and reduce the invasive ability. miR-126 significantly enhanced the sensitivity of the colon cancer cell to chemotherapeutic drug. It has been shown that IRS1, SLC75A and TOM1 were the potential target genes of miR-126 in colon cancer. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [4] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
SGC7901/ADR cells | Gastric | Homo sapiens (Human) | CVCL_VU57 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Caspase3/7 activity assay | |||
Mechanism Description | microRNA-126 increases chemosensitivity in drug-resistant gastric cancer cells by targeting EZH2. | |||
Disease Class: Non-small cell lung cancer | [5] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | PI3K/AKT signaling pathway | Inhibition | hsa04151 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | VEGF activates the downstream PI3k/Akt signaling pathway, which is a critical regulator of cellular growth, differentiation, and metabolism. miR-126 could overcome the resistance of NSCLC cells to antineoplastic drugs through inhibition of a VEGF-PI3k/Akt signaling pathway that resulted in the down-regulation of MRP1. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [7] | |||
Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Sensitive Drug | Epigallocatechin gallate | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
Experiment for Molecule Alteration |
Flow cytometry assay | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Overexpression of miR-126 sensitizes osteosarcoma cells to apoptosis induced by epigallocatechin-3-gallate. |
Clinical Trial Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Cervical cancer | [8] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | TRAIL | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR126 reverses drug resistance to TRAIL through inhibiting the expression of c-FLIP in cervical cancer miR126 promotes TRAIL-induced apoptosis in TRAIL-resistant cervical cancer cells and increases the sensitivity of Hela-TR and SiHa-TR to TNF-alphaand FasL. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.