Molecule Information
General Information of the Molecule (ID: Mol01434)
Name |
hsa-mir-9
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 9-1
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR9-1
|
||||
Gene ID | |||||
Location |
chr1:156420341-156420429[-]
|
||||
Sequence |
CGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAG
CUAGAUAACCGAAAGUAAAAAUAACCCCA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
NCI-H358 cells | Lung | Homo sapiens (Human) | CVCL_1559 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay; EdU assay | |||
Mechanism Description | microRNA-9 Enhanced Cisplatin Sensitivity in Nonsmall Cell Lung Cancer Cells by downregulating Eukaryotic Translation Initiation Factor 5A2. | |||
Disease Class: Ovarian cancer | [2] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Homologous-recombination | Regulation | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
CAOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0201 | |
C13 cells | Ovary | Homo sapiens (Human) | CVCL_0114 | |
OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Tumor onset measured | |||
Mechanism Description | miR-9 bound directly to the 3'-UTR of BRCA1 and downregulated BRCA1 expression in ovarian cancer cells, miR-9 mediates the downregulation of BRCA1 and impedes DNA damage repair in ovarian cancer, improve chemotherapeutic (like cisplatin) efficacy by increasing the sensitivity of cancer cells to DNA damage. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Acute myeloid leukemia | [3] | |||
Sensitive Disease | Acute myeloid leukemia [ICD-11: 2A60.0] | |||
Sensitive Drug | Daunorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | KG-1 cells | Bone marrow | Homo sapiens (Human) | CVCL_0374 |
THP-1 cells | Blood | Homo sapiens (Human) | CVCL_0006 | |
HL60 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0002 | |
Kasumi-1 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0589 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; EdU assay; Flow cytometry assay | |||
Mechanism Description | miR-9 improved the anti-tumor effects of Dnr by inhibiting myeloid cell leukemia-1 (MCL-1) expression, which was dependent on downregulation of EIF5A2 expression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Chronic myeloid leukemia | [4] | |||
Sensitive Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR9 regulates the multidrug resistance of chronic myelogenous leukemia by targeting ABCB1. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.