Molecule Information

General Information of the Molecule (ID: Mol01434)

• Name: hsa-mir-9 ,Homo sapiens
• Synonyms: microRNA 9-1
• Molecule Type: Precursor miRNA
• Gene Name: MIR9-1
• Gene ID: 407046
• Location: chr1:156420341-156420429[-]
• Sequence:
  CGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAG
  CUAGAUAACCGAAAGUAAAAAUAACCCCA
• Ensembl ID: ENSG00000207933
• HGNC ID: HGNC:31641
• Precursor Accession: MI0000466

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay; EdU assay
• Mechanism Description: microRNA-9 Enhanced Cisplatin Sensitivity in Nonsmall Cell Lung Cancer Cells by downregulating Eukaryotic Translation Initiation Factor 5A2.

Disease Class: Ovarian cancer [2]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Homologous-recombination; Regulation
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vitro Model: C13 cells; Ovary; Homo sapiens (Human); CVCL_0114
• In Vitro Model: OV2008 cells; Ovary; Homo sapiens (Human); CVCL_0473
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Tumor onset measured
• Mechanism Description: miR-9 bound directly to the 3'-UTR of BRCA1 and downregulated BRCA1 expression in ovarian cancer cells, miR-9 mediates the downregulation of BRCA1 and impedes DNA damage repair in ovarian cancer, improve chemotherapeutic (like cisplatin) efficacy by increasing the sensitivity of cancer cells to DNA damage.

Daunorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute myeloid leukemia [3]

• Sensitive Disease: Acute myeloid leukemia [ICD-11: 2A60.0]
• Sensitive Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: KG-1 cells; Bone marrow; Homo sapiens (Human); CVCL_0374
• In Vitro Model: THP-1 cells; Blood; Homo sapiens (Human); CVCL_0006
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: Kasumi-1 cells; Peripheral blood; Homo sapiens (Human); CVCL_0589
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; EdU assay; Flow cytometry assay
• Mechanism Description: miR-9 improved the anti-tumor effects of Dnr by inhibiting myeloid cell leukemia-1 (MCL-1) expression, which was dependent on downregulation of EIF5A2 expression.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [4]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR9 regulates the multidrug resistance of chronic myelogenous leukemia by targeting ABCB1.

References

• Ref 1: MicroRNA-9 Enhanced Cisplatin Sensitivity in Nonsmall Cell Lung Cancer Cells by Regulating Eukaryotic Translation Initiation Factor 5A2. Biomed Res Int. 2018 Aug 5;2018:1769040. doi: 10.1155/2018/1769040. eCollection 2018.
• Ref 2: miR-9 regulation of BRCA1 and ovarian cancer sensitivity to cisplatin and PARP inhibition. J Natl Cancer Inst. 2013 Nov 20;105(22):1750-8. doi: 10.1093/jnci/djt302. Epub 2013 Oct 29.
• Ref 3: miR-9 Enhances the Chemosensitivity of AML Cells to Daunorubicin by Targeting the EIF5A2/MCL-1 Axis. Int J Biol Sci. 2019 Jan 1;15(3):579-586. doi: 10.7150/ijbs.29775. eCollection 2019.
• Ref 4: miR-9 regulates the multidrug resistance of chronic myelogenous leukemia by targeting ABCB1. Oncol Rep. 2017 Apr;37(4):2193-2200. doi: 10.3892/or.2017.5464. Epub 2017 Feb 17.