Molecule Information
General Information of the Molecule (ID: Mol01422)
Name |
hsa-mir-135a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 135a-1
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR135A1
|
||||
Gene ID | |||||
Location |
chr3:52294219-52294308[-]
|
||||
Sequence |
AGGCCUCGCUGUUCUCUAUGGCUUUUUAUUCCUAUGUGAUUCUACUGCUCACUCAUAUAG
GGAUUGGAGCCGUGGCGCACGGCGGGGACA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
A549/CDDP cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Hsa-miR-135a/b could play a role in the development of CDDP resistance in lung cancer cell line at least in partby modulation of apoptosis via targeting MCL1. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Cervical cancer | [2] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Promega viability kit assay | |||
Mechanism Description | Down-regulated of FAk increased sensitivity of HeLa cancer cells to Fluorouracil chemotherapy, targeting and down-regulation of FAk expression by miR-135 and miR-138, overexpressed miR-138 and miR-135 had increased sensitivity to chemotherapy. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Cervical cancer | [2] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Promega viability kit assay | |||
Mechanism Description | Down-regulated of FAk increased sensitivity of HeLa cancer cells to Fluorouracil chemotherapy, targeting and down-regulation of FAk expression by miR-135 and miR-138, overexpressed miR-138 and miR-135 had increased sensitivity to chemotherapy. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [3] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Gefitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
Cell viability | Activation | hsa05200 | ||
PI3K/AKT signaling pathway | Activation | hsa04151 | ||
In Vitro Model | NCI-H1650 cells | Lung | Homo sapiens (Human) | CVCL_1483 |
NCI-H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay; Transwell assay | |||
Mechanism Description | miR-135a promoted cell growth and metastasis and activated the PI3k/AkT signaling pathway via a RAC1-dependent manner. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [4] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Gefitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
JAKT/STAT signaling pathway | Inhibition | hsa04630 | ||
In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
H157 cells | Lung | Homo sapiens (Human) | CVCL_2458 | |
H4006 cells | Lung | Homo sapiens (Human) | N.A. | |
NCI-H1650 cells | Lung | Homo sapiens (Human) | CVCL_1483 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR135 acted as a tumor promoter, and its suppression could improve sensitivity to gefitinib by targeting TRIM16 and inhibition of the JAk/STAT pathway. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [5] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Sp1/DAPK2 signaling signaling pathway | Inhibition | hsa05231 | |
In Vitro Model | MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
MGC-803/OXA cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
SGC7901/OXA cells | Gastric | Homo sapiens (Human) | CVCL_B0A1 | |
SNU-5 cells | Gastric | Homo sapiens (Human) | CVCL_0078 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR135a promotes gastric cancer progression and resistance to oxaliplatin. The mechanism whereby miR135a promotes GC pathogenesis appears to be the suppression of E2F1 expression and Sp1/DAPk2 pathway signaling. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [6] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Hypoxia-inducible factor 1-alpha inhibitor (HIF1AN) is a protein that binds to HIF-1alpha and inhibits its transcriptional activity. HIF1AN is a potential miR-135a target listed in both the TargetScan and PicTar databases. miR-135a-mediated paclitaxel resistance is in part mediated by downregulation of APC. | |||
Disease Class: Non-small cell lung cancer | [6] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Hypoxia-inducible factor 1-alpha inhibitor (HIF1AN) is a protein that binds to HIF-1alpha and inhibits its transcriptional activity. HIF1AN is a potential miR-135a target listed in both the TargetScan and PicTar databases. miR-135a-mediated paclitaxel resistance is in part mediated by downregulation of APC. | |||
Disease Class: Ovarian cancer | [6] | |||
Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Hypoxia-inducible factor 1-alpha inhibitor (HIF1AN) is a protein that binds to HIF-1alpha and inhibits its transcriptional activity. HIF1AN is a potential miR-135a target listed in both the TargetScan and PicTar databases. miR-135a-mediated paclitaxel resistance is in part mediated by downregulation of APC. | |||
Disease Class: Prostate cancer | [6] | |||
Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Hypoxia-inducible factor 1-alpha inhibitor (HIF1AN) is a protein that binds to HIF-1alpha and inhibits its transcriptional activity. HIF1AN is a potential miR-135a target listed in both the TargetScan and PicTar databases. miR-135a-mediated paclitaxel resistance is in part mediated by downregulation of APC. | |||
Disease Class: Uterine sarcoma | [6] | |||
Resistant Disease | Uterine sarcoma [ICD-11: 2C72.0] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Hypoxia-inducible factor 1-alpha inhibitor (HIF1AN) is a protein that binds to HIF-1alpha and inhibits its transcriptional activity. HIF1AN is a potential miR-135a target listed in both the TargetScan and PicTar databases. miR-135a-mediated paclitaxel resistance is in part mediated by downregulation of APC. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.