General Information of the Molecule (ID: Mol01421)
Name
hsa-mir-133a ,Homo sapiens
Synonyms
microRNA 133a-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR133A1
Gene ID
406922
Location
chr18:21825698-21825785[-]
Sequence
ACAAUGCUUUGCUAGAGCUGGUAAAAUGGAACCAAAUCGCCUCUUCAAUGGAUUUGGUCC
CCUUCAACCAGCUGUAGCUAUGCAUUGA
    Click to Show/Hide
Ensembl ID
ENSG00000283927
HGNC ID
HGNC:31517
Precursor Accession
MI0000450
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Laryngeal carcinoma [1]
Sensitive Disease Laryngeal carcinoma [ICD-11: 2C23.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model HEp-2 cells Skin Homo sapiens (Human) CVCL_1906
NP69 cells Nasopharynx Homo sapiens (Human) CVCL_F755
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Hep-2v cells persistently express high levels of ATP7B, and cisplatin treatment stimulates increased ATP7B expression of ATP7B in these cells. ATP7B contributes to the removal of intracellular cisplatin to the extracellular space, thereby promoting cell survival. However, ATP7B expression was significantly decreased following exogenous expression of miR-133a. Reduced levels of ATP7B likely impaired the transportation of cisplatin to the extracellular space, thereby increasing the sensitivity of Hep-2v cells to cisplatin.
Disease Class: Hepatocellular carcinoma [2]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-133a and miR-326 share a common target gene, Bcl-xl. Expression levels of miR-133a and miR-326 are significantly upregulated subsequent to transfection. miR-133a and miR-326 downregulate the mRNA expression of Bcl-xl. miR-133a and miR-326 sensitize HepG2 cells to 5-FU and DDP.
Disease Class: Breast cancer [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7/DOX cells Breast Homo sapiens (Human) CVCL_0031
CVCL_4V97 Breast Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Targeted downregulation of overexpressed FTL protein by microRNA miR-133a increases the sensitivity of drug-resistant cells to doxorubicin and cisplatin.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7/DOX cells Breast Homo sapiens (Human) CVCL_0031
CVCL_4V97 Breast Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Targeted downregulation of overexpressed FTL protein by microRNA miR-133a increases the sensitivity of drug-resistant cells to doxorubicin and cisplatin.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [2]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-133a and miR-326 share a common target gene, Bcl-xl. Expression levels of miR-133a and miR-326 are significantly upregulated subsequent to transfection. miR-133a and miR-326 downregulate the mRNA expression of Bcl-xl. miR-133a and miR-326 sensitize HepG2 cells to 5-FU and DDP.
Sunitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Renal cell carcinoma [4]
Resistant Disease Renal cell carcinoma [ICD-11: 2C90.0]
Resistant Drug Sunitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
In Vitro Model Caki-2 cells Kidney Homo sapiens (Human) CVCL_0235
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description High expression of miR-942, miR-628-5p, miR-133a, and miR-484 was significantly associated with decreased time to progression and overall survival. These microRNAs were also overexpressed in the sunitinib resistant cell line Caki-2 in comparison with the sensitive cell line.
References
Ref 1 miR-133a enhances the sensitivity of Hep-2 cells and vincristine-resistant Hep-2v cells to cisplatin by downregulating ATP7B expression. Int J Mol Med. 2016 Jun;37(6):1636-42. doi: 10.3892/ijmm.2016.2569. Epub 2016 Apr 20.
Ref 2 MicroRNA 133a and microRNA 326 co contribute to hepatocellular carcinoma 5 fluorouracil and cisplatin sensitivity by directly targeting B cell lymphoma extra large. Mol Med Rep. 2015 Oct;12(4):6235-40. doi: 10.3892/mmr.2015.4134. Epub 2015 Jul 29.
Ref 3 Iron metabolism disturbances in the MCF-7 human breast cancer cells with acquired resistance to doxorubicin and cisplatin. Int J Oncol. 2013 Nov;43(5):1481-6. doi: 10.3892/ijo.2013.2063. Epub 2013 Aug 20.
Ref 4 Identification of tissue microRNAs predictive of sunitinib activity in patients with metastatic renal cell carcinoma. PLoS One. 2014 Jan 24;9(1):e86263. doi: 10.1371/journal.pone.0086263. eCollection 2014.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.