Molecule Information

General Information of the Molecule (ID: Mol01392)

• Name: hsa-mir-204 ,Homo sapiens
• Synonyms: microRNA 204
• Molecule Type: Precursor miRNA
• Gene Name: MIR204
• Gene ID: 406987
• Location: chr9:70809975-70810084[-]
• Sequence:
  GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAU
  AUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC
• Ensembl ID: ENSG00000207935
• HGNC ID: HGNC:31582
• Precursor Accession: MI0000284

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 12 drug(s) in total

Arsenic trioxide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] [1]

• Sensitive Disease: Acute myeloid leukemia [ICD-11: 2A60.0]
• Sensitive Drug: Arsenic trioxide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cancer progression; Inhibition; hsa05200
• In Vitro Model: AML-5 cells; Peripheral blood; Homo sapiens (Human); CVCL_1620
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-204 decreases ATO chemoresistance in AML cells at least partially via promoting BIRC6/p53-mediated apoptosis.

Cetuximab

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1] [2]

• Sensitive Disease: Head and neck squamous cell carcinoma [ICD-11: 2D42.1]
• Sensitive Drug: Cetuximab
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: JAKT2/STAT3 signaling pathway; Inhibition; hsa04030
• In Vitro Model: 5-8F cells; Nasopharynx; Homo sapiens (Human); CVCL_C528
• In Vitro Model: CNE2 cells; Nasopharynx; Homo sapiens (Human); CVCL_6889
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR204 inhibits angiogenesis and promotes sensitivity to cetuximab in head and neck squamous cell carcinoma cells by blocking JAk2-STAT3 signaling.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [ICD-11: 2A00.1] [3]

• Resistant Disease: Glioma [ICD-11: 2A00.1]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: SNB19 cells; Brain; Homo sapiens (Human); CVCL_0535
• In Vitro Model: U373 cells; Brain; Homo sapiens (Human); CVCL_2219
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assays
• Mechanism Description: Knockdown of LncRNA HOXD-AS1 suppresses proliferation, migration and invasion and enhances cisplatin sensitivity of glioma cells by sponging miR-20.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioma [ICD-11: 2A00.1] [3]

• Sensitive Disease: Glioma [ICD-11: 2A00.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vitro Model: SNB19 cells; Brain; Homo sapiens (Human); CVCL_0535
• In Vitro Model: U373 cells; Brain; Homo sapiens (Human); CVCL_2219
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assays
• Mechanism Description: miR-204 overexpression suppressed proliferation, migration and invasion and enhanced the DDP sensitivity in glioma cells.

Disease Class: Neuroblastoma [ICD-11: 2A00.11] [4]

• Sensitive Disease: Neuroblastoma [ICD-11: 2A00.11]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: Kelly cells; Adrenal; Homo sapiens (Human); CVCL_2092
• In Vitro Model: Sk-N-AS cells; Adrenal; Homo sapiens (Human); CVCL_1700
• In Vitro Model: SH-SY5Y cells; Abdomen; Homo sapiens (Human); CVCL_0019
• In Vivo Model: Orthotopic xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-204 direct targeting of the 3' UTR of BCL2 and NTRk2 (TrkB). BCL2 has a critical role in ensuring the survival of early developing cell types, NTRk2 is also a well-established pro-survival oncogene in neuroblastoma, signalling the activation of the PI3k/AkT pathway, a significant mechanism of drug resistance in neuroblastoma. Ectopic miR-204 expression significantly increased sensitivity to cisplatin and etoposide in vitro.

Cyclophosphamide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Cyclophosphamide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Low miR-024 expression was enhancing chemotherapeutic resistance of breast cancer patients.

Docetaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [6]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: UCA1/miR204/Sirt1 signaling pathway; Activation; hsa05206
• In Vitro Model: LNCaP cells; Prostate; Homo sapiens (Human); CVCL_0395
• In Vitro Model: 22RV1 cells; Prostate; Homo sapiens (Human); CVCL_1045
• In Vitro Model: PNT2 cells; Prostate; Homo sapiens (Human); CVCL_2164
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Annexin V-FITC Apoptosis assay; Flow cytometer
• Mechanism Description: The UCA1/miR204/Sirt1 axis modulates docetaxel sensitivity of prostate cancer cells. UCA1 upregulation directly resulted in decreased miR204 expression.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [7]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: HMGB1 signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: AKT/mTOR/Rac1 signalling pathway; Regulation; N.A.
• In Vitro Model: SH-SY5Y cells; Abdomen; Homo sapiens (Human); CVCL_0019
• In Vitro Model: Kelly cells; Adrenal; Homo sapiens (Human); CVCL_2092
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Luminescence-based cell viability analysis
• Mechanism Description: However, it certainly is of interest to highlight the possible involvement of such miRNAs in affecting the most common means of chemoresistance-inducing cellular pathways within such cell lines. A typical example would be the effect of such miRNAs on the ABC transporter system and its member genes that regulate drug efflux properties of the cell.

Epirubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Epirubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Low miR-024 expression was enhancing chemotherapeutic resistance of breast cancer patients.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.11] [4]

• Sensitive Disease: Neuroblastoma [ICD-11: 2A00.11]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: Kelly cells; Adrenal; Homo sapiens (Human); CVCL_2092
• In Vitro Model: Sk-N-AS cells; Adrenal; Homo sapiens (Human); CVCL_1700
• In Vitro Model: SH-SY5Y cells; Abdomen; Homo sapiens (Human); CVCL_0019
• In Vivo Model: Orthotopic xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-204 direct targeting of the 3' UTR of BCL2 and NTRk2 (TrkB). BCL2 has a critical role in ensuring the survival of early developing cell types, NTRk2 is also a well-established pro-survival oncogene in neuroblastoma, signalling the activation of the PI3k/AkT pathway, a significant mechanism of drug resistance in neuroblastoma. Ectopic miR-204 expression significantly increased sensitivity to cisplatin and etoposide in vitro.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [5]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Low miR-024 expression was enhancing chemotherapeutic resistance of breast cancer patients.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [8]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: GTL-16 cells; Gastric; Homo sapiens (Human); CVCL_7668
• In Vivo Model: CD1 nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-204 targeted Bcl-2 messenger RNA and increased responsiveness of GC cells to 5-fluorouracil and oxaliplatin treatment. Ectopic expression of Bcl-2 protein counteracted miR-204 pro-apoptotic activity in response to 5-fluorouracil.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [9]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-beta signaling pathway; Inhibition; hsa04350
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Caspase 3 assay kit
• Mechanism Description: Sensitization of Gastric Cancer Cells to 5-FU by microRNA-204 Through Targeting the TGFBR2-Mediated Epithelial to Mesenchymal Transition.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [10]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SUIT-2 cells; Pancreas; Homo sapiens (Human); CVCL_3172
• In Vitro Model: Capan-1 cells; Pancreas; Homo sapiens (Human); CVCL_0237
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Propidium Iodide Assay
• Mechanism Description: They play key roles in regulating the translation and degradation of mRNAs through base pairing to partially complementary sites, predominantly in the 3'-untranslated regions of mRNAs.miR-204 has been also reported to be downregulated in intrahepatic cholangiocarcinoma, and the level of miR-204 expression was inversely correlated with that of Bcl-2 expression, possibly leading to chemotherapeutic drug-triggered apoptosis.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [8]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: GTL-16 cells; Gastric; Homo sapiens (Human); CVCL_7668
• In Vivo Model: CD1 nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-204 targeted Bcl-2 messenger RNA and increased responsiveness of GC cells to 5-fluorouracil and oxaliplatin treatment. Ectopic expression of Bcl-2 protein counteracted miR-204 pro-apoptotic activity in response to 5-fluorouracil.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [11]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780CIS cells; Ovary; Homo sapiens (Human); CVCL_1942
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: RT-qPCR; TaqMan assay; Northern blot analysis; Western blot; Luciferase assay
• Mechanism Description: A microarray platform optimised for the analysis of a panel of 381 human microRNA was used to analyse and compare the pattern of microRNAs expression between parental human ovarian cancer A2780wt cell line and its counterparts made resistant to cisplatin (A2780CIS) and paclitaxel (A2780TAX, resistance P-glycoprotein-dependent), and TC1/TC3, made resistant to paclitaxel in the presence of cyclosporine as inhibitor of P-glycoprotein. The expression of hsa-mir-204 is decreased in drug-resistant cells.

References

• Ref 1: MicroRNA-204 Potentiates the Sensitivity of Acute Myeloid Leukemia Cells to Arsenic Trioxide. Oncol Res. 2019 Sep 23;27(9):1035-1042. doi: 10.3727/096504019X15528367532612. Epub 2019 Apr 8.
• Ref 2: miR-204 inhibits angiogenesis and promotes sensitivity to cetuximab in head and neck squamous cell carcinoma cells by blocking JAK2-STAT3 signaling. Biomed Pharmacother. 2018 Mar;99:278-285. doi: 10.1016/j.biopha.2018.01.055.
• Ref 3: Knockdown of lncRNA HOXD-AS1 suppresses proliferation, migration and invasion and enhances cisplatin sensitivity of glioma cells by sponging miR-204. Biomed Pharmacother. 2019 Apr;112:108633. doi: 10.1016/j.biopha.2019.108633. Epub 2019 Feb 20.
• Ref 4: MicroRNA-204 increases sensitivity of neuroblastoma cells to cisplatin and is associated with a favourable clinical outcome. Br J Cancer. 2012 Sep 4;107(6):967-76. doi: 10.1038/bjc.2012.356. Epub 2012 Aug 14.
• Ref 5: Decreased expression of miR-204 is associated with poor prognosis in patients with breast cancer. Int J Clin Exp Pathol. 2014 May 15;7(6):3287-92. eCollection 2014.
• Ref 6: The UCA1/miR-204/Sirt1 axis modulates docetaxel sensitivity of prostate cancer cells. Cancer Chemother Pharmacol. 2016 Nov;78(5):1025-1031. doi: 10.1007/s00280-016-3158-8. Epub 2016 Sep 29.
• Ref 7: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 8: miR-204 targets Bcl-2 expression and enhances responsiveness of gastric cancer. Cell Death Dis. 2012 Nov 15;3(11):e423. doi: 10.1038/cddis.2012.160.
• Ref 9: Sensitization of Gastric Cancer Cells to 5-FU by MicroRNA-204 Through Targeting the TGFBR2-Mediated Epithelial to Mesenchymal Transition. Cell Physiol Biochem. 2018;47(4):1533-1545. doi: 10.1159/000490871. Epub 2018 Jun 21.
• Ref 10: MicroRNA expression as a predictive marker for gemcitabine response after surgical resection of pancreatic cancer. Ann Surg Oncol. 2011 Aug;18(8):2381-7. doi: 10.1245/s10434-011-1602-x. Epub 2011 Feb 23.
• Ref 11: Role of microRNAs in drug-resistant ovarian cancer cells. Gynecol Oncol. 2008 Dec;111(3):478-86. doi: 10.1016/j.ygyno.2008.08.017. Epub 2008 Sep 26.