Molecule Information

General Information of the Molecule (ID: Mol01386)

• Name: hsa-mir-181c ,Homo sapiens
• Synonyms: microRNA 181c
• Molecule Type: Precursor miRNA
• Gene Name: MIR181C
• Gene ID: 406957
• Location: chr19:13874699-13874808[+]
• Sequence:
  CGGAAAAUUUGCCAAGGGUUUGGGGGAACAUUCAACCUGUCGGUGAGUUUGGGCAGCUCA
  GGCAAACCAUCGACCGUUGAGUGGACCCUGAGGCCUGGAAUUGCCAUCCU
• Ensembl ID: ENSG00000207613
• HGNC ID: HGNC:31552
• Precursor Accession: MI0000271

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [1]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Activation; hsa04310
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: H1299/DDP cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: 16HBE cells; Lung; Homo sapiens (Human); CVCL_0112
• In Vitro Model: A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometric analysis
• Mechanism Description: miR181c contributed to DDP resistance in NSCLC cells through activation of the Wnt/beta-catenin pathway by targeting WIF1. miR181c egatively regulates the expression of WIF1, anti-miR181c suppressed the Wnt/beta-catenin pathway by regulating WIF1.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell colony; Inhibition; hsa05200
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: p53 signaling pathway; Activation; hsa04115
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: The microRNA miR-181c enhances chemosensitivity and reduces chemoresistance in breast cancer cells via down-regulating osteopontin.

Disease Class: Chronic myeloid leukemia [3]

• Sensitive Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: Ku812 cells; Bone marrow; Homo sapiens (Human); CVCL_0379
• In Vitro Model: kCL22 cells; Pleural effusion; Homo sapiens (Human); CVCL_2091
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-181c directly targeted and inhibited the ST8SIA4 expression, as well as miR-181c was inversely correlated with the levels of ST8SIA4 expression in CML cell lines and samples. Moreover, ST8SIA4 could reverse the effect of miR-181c on drug resistance in k562 and k562/ADR cells in vitro. Upregulation of miR-181c sensitized k562/ADR cells to adriamycin in vivo through directly suppressing ST8SIA4 expression. Further investigation showed that miR-181c mediated the activity of phosphoinositide-3 kinase (PI3k)/AkT signal pathway, and inhibition of PI3k/Akt in k562 cells counteracted miR-181c-mediated MDR phenotype.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [4]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Hippo signaling pathway; Regulation; hsa04392
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-181c directly repressed MST1, LATS2, MOB1 and SAV1 expression in human pancreatic cancer cells. Overexpression of miR-181c induced hyperactivation of the YAP/TAZ and (+) expression of the Hippo signaling downstream genes CTGF, BIRC5 and BLC2L1, leading to pancreatic cancer cell survival and chemoresistance in vitro and in vivo. Importantly, high miR-181c levels were significantly correlated with Hippo signaling inactivation in pancreatic cancer samples, and predicted a poor patient overall survival.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [4]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Hippo signaling pathway; Regulation; hsa04392
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-181c directly repressed MST1, LATS2, MOB1 and SAV1 expression in human pancreatic cancer cells. Overexpression of miR-181c induced hyperactivation of the YAP/TAZ and (+) expression of the Hippo signaling downstream genes CTGF, BIRC5 and BLC2L1, leading to pancreatic cancer cell survival and chemoresistance in vitro and in vivo. Importantly, high miR-181c levels were significantly correlated with Hippo signaling inactivation in pancreatic cancer samples, and predicted a poor patient overall survival.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [5]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Response evaluation criteria in solid tumors assay
• Mechanism Description: Significant down-regulation of miR-181c in imatinib-resistant versus imatinib-responders was confirmed by qRT-PCR. Some miR-181c target genes such as PBX3, HSP90B1, NMT2 and RAD21 have been associated with drug response.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [4]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Hippo signaling pathway; Regulation; hsa04392
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: miR-181c directly repressed MST1, LATS2, MOB1 and SAV1 expression in human pancreatic cancer cells. Overexpression of miR-181c induced hyperactivation of the YAP/TAZ and (+) expression of the Hippo signaling downstream genes CTGF, BIRC5 and BLC2L1, leading to pancreatic cancer cell survival and chemoresistance in vitro and in vivo. Importantly, high miR-181c levels were significantly correlated with Hippo signaling inactivation in pancreatic cancer samples, and predicted a poor patient overall survival.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [6]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Ras-associated protein 1 (Rap1), a growth regulatory protein, belongs to a member of RAS-like small GTP-binding protein superfamily. Rap1 regulates several basic cellular functions: migration, adhesion and growth. TMZ can inhibit the Rap1B expression to exert its cell killing by upregulating miR-181a/b/c/d subunits; conversely, each miR-181a/b/c/d subunit enhanced the chemosensitivity of TMZ in glioblastoma.

References

• Ref 1: miR-181c contributes to cisplatin resistance in non-small cell lung cancer cells by targeting Wnt inhibition factor 1. Cancer Chemother Pharmacol. 2017 Nov;80(5):973-984. doi: 10.1007/s00280-017-3435-1. Epub 2017 Sep 27.
• Ref 2: The microRNA miR-181c enhances chemosensitivity and reduces chemoresistance in breast cancer cells via down-regulating osteopontin. Int J Biol Macromol. 2019 Mar 15;125:544-556. doi: 10.1016/j.ijbiomac.2018.12.075. Epub 2018 Dec 8.
• Ref 3: Upregulation of miR-181c inhibits chemoresistance by targeting ST8SIA4 in chronic myelocytic leukemia. Oncotarget. 2016 Sep 13;7(37):60074-60086. doi: 10.18632/oncotarget.11054.
• Ref 4: Upregulation of miR-181c contributes to chemoresistance in pancreatic cancer by inactivating the Hippo signaling pathway. Oncotarget. 2015 Dec 29;6(42):44466-79. doi: 10.18632/oncotarget.6298.
• Ref 5: Down-regulation of miR-181c in imatinib-resistant chronic myeloid leukemia. Mol Cytogenet. 2013 Jul 16;6(1):27. doi: 10.1186/1755-8166-6-27.
• Ref 6: miR-181 subunits enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeleton remodeling in glioblastoma cells. Med Oncol. 2014 Apr;31(4):892. doi: 10.1007/s12032-014-0892-9. Epub 2014 Feb 27.