Molecule Information
General Information of the Molecule (ID: Mol01386)
| Name |
hsa-mir-181c
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 181c
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR181C
|
||||
| Gene ID | |||||
| Location |
chr19:13874699-13874808[+]
|
||||
| Sequence |
CGGAAAAUUUGCCAAGGGUUUGGGGGAACAUUCAACCUGUCGGUGAGUUUGGGCAGCUCA
GGCAAACCAUCGACCGUUGAGUGGACCCUGAGGCCUGGAAUUGCCAUCCU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Wnt/Beta-catenin signaling pathway | Activation | hsa04310 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| H1299/DDP cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| 16HBE cells | Lung | Homo sapiens (Human) | CVCL_0112 | |
| A549/DDP cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
| Mechanism Description | miR181c contributed to DDP resistance in NSCLC cells through activation of the Wnt/beta-catenin pathway by targeting WIF1. miR181c egatively regulates the expression of WIF1, anti-miR181c suppressed the Wnt/beta-catenin pathway by regulating WIF1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell colony | Inhibition | hsa05200 | ||
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell viability | Inhibition | hsa05200 | ||
| p53 signaling pathway | Activation | hsa04115 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | The microRNA miR-181c enhances chemosensitivity and reduces chemoresistance in breast cancer cells via down-regulating osteopontin. | |||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [3] | |||
| Sensitive Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| Ku812 cells | Bone marrow | Homo sapiens (Human) | CVCL_0379 | |
| kCL22 cells | Pleural effusion | Homo sapiens (Human) | CVCL_2091 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-181c directly targeted and inhibited the ST8SIA4 expression, as well as miR-181c was inversely correlated with the levels of ST8SIA4 expression in CML cell lines and samples. Moreover, ST8SIA4 could reverse the effect of miR-181c on drug resistance in k562 and k562/ADR cells in vitro. Upregulation of miR-181c sensitized k562/ADR cells to adriamycin in vivo through directly suppressing ST8SIA4 expression. Further investigation showed that miR-181c mediated the activity of phosphoinositide-3 kinase (PI3k)/AkT signal pathway, and inhibition of PI3k/Akt in k562 cells counteracted miR-181c-mediated MDR phenotype. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [4] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Hippo signaling pathway | Regulation | N.A. | ||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-181c directly repressed MST1, LATS2, MOB1 and SAV1 expression in human pancreatic cancer cells. Overexpression of miR-181c induced hyperactivation of the YAP/TAZ and (+) expression of the Hippo signaling downstream genes CTGF, BIRC5 and BLC2L1, leading to pancreatic cancer cell survival and chemoresistance in vitro and in vivo. Importantly, high miR-181c levels were significantly correlated with Hippo signaling inactivation in pancreatic cancer samples, and predicted a poor patient overall survival. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [4] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Hippo signaling pathway | Regulation | N.A. | ||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-181c directly repressed MST1, LATS2, MOB1 and SAV1 expression in human pancreatic cancer cells. Overexpression of miR-181c induced hyperactivation of the YAP/TAZ and (+) expression of the Hippo signaling downstream genes CTGF, BIRC5 and BLC2L1, leading to pancreatic cancer cell survival and chemoresistance in vitro and in vivo. Importantly, high miR-181c levels were significantly correlated with Hippo signaling inactivation in pancreatic cancer samples, and predicted a poor patient overall survival. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [5] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Response evaluation criteria in solid tumors assay | |||
| Mechanism Description | Significant down-regulation of miR-181c in imatinib-resistant versus imatinib-responders was confirmed by qRT-PCR. Some miR-181c target genes such as PBX3, HSP90B1, NMT2 and RAD21 have been associated with drug response. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [4] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Hippo signaling pathway | Regulation | N.A. | ||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-181c directly repressed MST1, LATS2, MOB1 and SAV1 expression in human pancreatic cancer cells. Overexpression of miR-181c induced hyperactivation of the YAP/TAZ and (+) expression of the Hippo signaling downstream genes CTGF, BIRC5 and BLC2L1, leading to pancreatic cancer cell survival and chemoresistance in vitro and in vivo. Importantly, high miR-181c levels were significantly correlated with Hippo signaling inactivation in pancreatic cancer samples, and predicted a poor patient overall survival. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [7] | |||
| Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Ras-associated protein 1 (Rap1), a growth regulatory protein, belongs to a member of RAS-like small GTP-binding protein superfamily. Rap1 regulates several basic cellular functions: migration, adhesion and growth. TMZ can inhibit the Rap1B expression to exert its cell killing by upregulating miR-181a/b/c/d subunits; conversely, each miR-181a/b/c/d subunit enhanced the chemosensitivity of TMZ in glioblastoma. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [8] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Verapamil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] | [9] | |||
| Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot | |||
| Experiment for Drug Resistance |
MTT assay; Apoptosis assay | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [9] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Vincristine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot | |||
| Experiment for Drug Resistance |
MTT assay; Apoptosis assay | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
