Molecule Information
General Information of the Molecule (ID: Mol01352)
| Name |
hsa-mir-30a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 30a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR30A
|
||||
| Gene ID | |||||
| Location |
chr6:71403551-71403621[-]
|
||||
| Sequence |
GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUG
UUUGCAGCUGC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] | [1] | |||
| Resistant Disease | Prolactin-secreting adenoma [ICD-11: 2F37.Y] | |||
| Resistant Drug | Bromocriptine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | KHM-5M cells | Pleural effusion | Homo sapiens (Human) | CVCL_2975 |
| Experiment for Molecule Alteration |
Solexa sequencing assay; qRT-PCR | |||
| Experiment for Drug Resistance |
Clinical diagnostic evaluation | |||
| Mechanism Description | Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [2] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| Experiment for Molecule Alteration |
RT-sqPCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | The IC50 of CDDP in the SGC7901/CDDP-miR-30a mimics group was decreased to 8.56 M (P<0.001 vs. SGC7901/CDDP group), indicating increased chemosensitivity following miR-30a transfectionand the expression of P-gp protein was notably elevated in SGC7901/CDDP cells compared with SGC7901 cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [3] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
RT-qPCR; Western blot analysiss | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | EMT is associated with cisplatin resistance in gastric cancer. miR-30a is an important miRNA modulating EMT and cisplatin sensitivity of SGC-7901 and SGC-7901/DDP cells. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [4] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | AKT/MAPK signaling pathway | Inhibition | hsa04010 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | HEY cells | Ovary | Homo sapiens (Human) | CVCL_0297 |
| A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| OVCA433 cells | Ovary | Homo sapiens (Human) | CVCL_0475 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Trypan blue dye exclusion method assay; Transwell assay | |||
| Mechanism Description | Overexpression of miR-30a decreases cellular vitality, invasion, plasticity and EMT. ETAR is identified as a direct target of miR-30a, and their expression is inversely correlated in EOC cell lines and human tissue samples. Upregulation of miR-30a re-sensitizes resistant EOC cells to cisplatinum by binding ETAR. Overexpression of miR-30a inhibits tumor growth in cisplatinum-resistant xenografts. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [5] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy. | |||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [5] | |||
| Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [5] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [5] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | HepS cells | Liver | Homo sapiens (Human) | N.A. |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy. | |||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [6] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR30a can decrease multidrug resistance (MDR) of gastric cancer cells, miR30a overexpression decreased the expression of P-gp, a MDR-related protein. It is also an important miRNA modulating EMT of the cancer cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [7] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
qRT-PCR; Western blot; Dual luciferase assay | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [8] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Down-regulation of miR-30a contributed to chemoresistance of osteosarcoma cells through regulating autophagy. Furthermore, to investigate the mechanism of miR-130a in regulating autophagy, bioinformatics analysis was performed. The results showed that the 3'-UTR region of Beclin-1 were the binding sites for miR-30a. Consistently, previous studies demonstrated that Beclin-1 was the directly target of miR-30a. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [6] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC-7901/DDP cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR30a can decrease multidrug resistance (MDR) of gastric cancer cells, miR30a overexpression decreased the expression of P-gp, a MDR-related protein. It is also an important miRNA modulating EMT of the cancer cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [9] | |||
| Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell colony | Inhibition | hsa05200 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| SNAI1/IRS1/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
| SW1990 cells | Pancreas | Homo sapiens (Human) | CVCL_1723 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | miR-30a overexpression suppresses cell proliferation, and sensitizes pancreatic cancer cells to gemcitabine and miR-30a overexpression reduced IRS1 and SNAI1 protein level. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [10], [11] | |||
| Sensitive Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Sensitive Drug | Imatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Intrinsic apoptotic signaling pathway | Activation | hsa04210 | ||
| Mitochondrial signaling pathway | Activation | hsa04217 | ||
| In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | miR-30a mimic or knockdown of autophagy genes (ATGs) such as Beclin 1 and ATG5 by short hairpin RNA enhances imatinib-induced cytotoxicity and promotes mitochondria-dependent intrinsic apoptosis. In contrast, knockdown of miR-30a by antagomiR-30a increases the expression of Beclin 1 and ATG5, and inhibits imatinib-induced cytotoxicity. And MIR30A mimics, as well as knockdown of BECN1 and ATG5, increases intrinsic apoptotic pathways. | |||
| Drug Sensitive Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [12] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MDA-MB-435 cells | Breast | Homo sapiens (Human) | CVCL_0417 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| MDA-MB-436 cells | Breast | Homo sapiens (Human) | CVCL_0623 | |
| SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
| BT474 cells | Breast | Homo sapiens (Human) | CVCL_0179 | |
| Experiment for Molecule Alteration |
miRNA Microarray Expression Analysis; qRT-PCR; RT-PCR; Luciferase Reporter Assay; Western blot | |||
| Experiment for Drug Resistance |
Apoptosis Assay; Cell Viability Assay | |||
| Mechanism Description | Taken together, our data strongly support a central role for miR-125b in conferring Taxol resistance through the suppression of Bak1 expression. | |||
| Drug Sensitive Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] | [13] | |||
| Sensitive Disease | Renal cell carcinoma [ICD-11: 2C90.0] | |||
| Sensitive Drug | Sorafenib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Autophagy | Regulation | N.A. | |
| In Vitro Model | 786-0 cells | Kidney | Homo sapiens (Human) | CVCL_1051 |
| A498 cells | Kidney | Homo sapiens (Human) | CVCL_1056 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Knockdown of miR-30a by introducing antagomiR-30a increased Beclin-1 expression, and inhibited sorafenib-induced cytotoxicity against RCC cells. Autophagy inhibitors, including chloroquine, 3-methyaldenine or Bafliomycin A1, enhanced sorafenib activity, causing substantial cell apoptosis. Meanwhile, knockdown of Beclin-1 or ATG-5 by targeted siRNAs also increased sorafenib-induced cytotoxicity in above RCC cells. These findings indicate that dysregulation of miR-30a in RCC may interfere with the effectiveness of sorafenib-mediated apoptosis by an autophagy-dependent pathway, thus representing a novel potential therapeutic target for RCC. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
