General Information of the Molecule (ID: Mol01352)
Name
hsa-mir-30a ,Homo sapiens
Synonyms
microRNA 30a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR30A
Gene ID
407029
Location
chr6:71403551-71403621[-]
Sequence
GCGACUGUAAACAUCCUCGACUGGAAGCUGUGAAGCCACAGAUGGGCUUUCAGUCGGAUG
UUUGCAGCUGC
    Click to Show/Hide
Ensembl ID
ENSG00000207827
HGNC ID
HGNC:31624
Precursor Accession
MI0000088
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Bromocriptine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] [1]
Resistant Disease Prolactin-secreting adenoma [ICD-11: 2F37.Y]
Resistant Drug Bromocriptine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model KHM-5M cells Pleural effusion Homo sapiens (Human) CVCL_2975
Experiment for
Molecule Alteration
Solexa sequencing assay; qRT-PCR
Experiment for
Drug Resistance
Clinical diagnostic evaluation
Mechanism Description Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
RT-sqPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description The IC50 of CDDP in the SGC7901/CDDP-miR-30a mimics group was decreased to 8.56 M (P<0.001 vs. SGC7901/CDDP group), indicating increased chemosensitivity following miR-30a transfectionand the expression of P-gp protein was notably elevated in SGC7901/CDDP cells compared with SGC7901 cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
RT-qPCR; Western blot analysiss
Experiment for
Drug Resistance
MTT assay
Mechanism Description EMT is associated with cisplatin resistance in gastric cancer. miR-30a is an important miRNA modulating EMT and cisplatin sensitivity of SGC-7901 and SGC-7901/DDP cells.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [4]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT/MAPK signaling pathway Inhibition hsa04010
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
In Vitro Model HEY cells Ovary Homo sapiens (Human) CVCL_0297
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
OVCA433 cells Ovary Homo sapiens (Human) CVCL_0475
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Trypan blue dye exclusion method assay; Transwell assay
Mechanism Description Overexpression of miR-30a decreases cellular vitality, invasion, plasticity and EMT. ETAR is identified as a direct target of miR-30a, and their expression is inversely correlated in EOC cell lines and human tissue samples. Upregulation of miR-30a re-sensitizes resistant EOC cells to cisplatinum by binding ETAR. Overexpression of miR-30a inhibits tumor growth in cisplatinum-resistant xenografts.
Disease Class: Breast cancer [ICD-11: 2C60.3] [5]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [5]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [5]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy.
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [5]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HepS cells Liver Homo sapiens (Human) N.A.
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-30a can sensitize tumor cells to cis-DDP via reducing beclin 1-mediated autophagy.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [6]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR30a can decrease multidrug resistance (MDR) of gastric cancer cells, miR30a overexpression decreased the expression of P-gp, a MDR-related protein. It is also an important miRNA modulating EMT of the cancer cells.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [7]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
qRT-PCR; Western blot; Dual luciferase assay
Experiment for
Drug Resistance
Cell viability assay
Mechanism Description Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [8]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Down-regulation of miR-30a contributed to chemoresistance of osteosarcoma cells through regulating autophagy. Furthermore, to investigate the mechanism of miR-130a in regulating autophagy, bioinformatics analysis was performed. The results showed that the 3'-UTR region of Beclin-1 were the binding sites for miR-30a. Consistently, previous studies demonstrated that Beclin-1 was the directly target of miR-30a.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [6]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC-7901/DDP cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR30a can decrease multidrug resistance (MDR) of gastric cancer cells, miR30a overexpression decreased the expression of P-gp, a MDR-related protein. It is also an important miRNA modulating EMT of the cancer cells.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [9]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell colony Inhibition hsa05200
Cell proliferation Inhibition hsa05200
SNAI1/IRS1/AKT signaling pathway Regulation N.A.
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description miR-30a overexpression suppresses cell proliferation, and sensitizes pancreatic cancer cells to gemcitabine and miR-30a overexpression reduced IRS1 and SNAI1 protein level.
Imatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [10], [11]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Sensitive Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Intrinsic apoptotic signaling pathway Activation hsa04210
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description miR-30a mimic or knockdown of autophagy genes (ATGs) such as Beclin 1 and ATG5 by short hairpin RNA enhances imatinib-induced cytotoxicity and promotes mitochondria-dependent intrinsic apoptosis. In contrast, knockdown of miR-30a by antagomiR-30a increases the expression of Beclin 1 and ATG5, and inhibits imatinib-induced cytotoxicity. And MIR30A mimics, as well as knockdown of BECN1 and ATG5, increases intrinsic apoptotic pathways.
Paclitaxel
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [12]
Sensitive Disease Breast cancer [ICD-11: 2C60.2]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MDA-MB-435 cells Breast Homo sapiens (Human) CVCL_0417
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
BT474 cells Breast Homo sapiens (Human) CVCL_0179
Experiment for
Molecule Alteration
miRNA Microarray Expression Analysis; qRT-PCR; RT-PCR; Luciferase Reporter Assay; Western blot
Experiment for
Drug Resistance
Apoptosis Assay; Cell Viability Assay
Mechanism Description Taken together, our data strongly support a central role for miR-125b in conferring Taxol resistance through the suppression of Bak1 expression.
Sorafenib
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [13]
Sensitive Disease Renal cell carcinoma [ICD-11: 2C90.0]
Sensitive Drug Sorafenib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Autophagy Regulation N.A.
In Vitro Model 786-0 cells Kidney Homo sapiens (Human) CVCL_1051
A498 cells Kidney Homo sapiens (Human) CVCL_1056
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Knockdown of miR-30a by introducing antagomiR-30a increased Beclin-1 expression, and inhibited sorafenib-induced cytotoxicity against RCC cells. Autophagy inhibitors, including chloroquine, 3-methyaldenine or Bafliomycin A1, enhanced sorafenib activity, causing substantial cell apoptosis. Meanwhile, knockdown of Beclin-1 or ATG-5 by targeted siRNAs also increased sorafenib-induced cytotoxicity in above RCC cells. These findings indicate that dysregulation of miR-30a in RCC may interfere with the effectiveness of sorafenib-mediated apoptosis by an autophagy-dependent pathway, thus representing a novel potential therapeutic target for RCC.
References
Ref 1 MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
Ref 2 miR-30 decreases multidrug resistance in human gastric cancer cells by modulating cell autophagy. Exp Ther Med. 2018 Jan;15(1):599-605. doi: 10.3892/etm.2017.5354. Epub 2017 Oct 23.
Ref 3 MiR-30a increases cisplatin sensitivity of gastric cancer cells through suppressing epithelial-to-mesenchymal transition (EMT). Eur Rev Med Pharmacol Sci. 2016 May;20(9):1733-9.
Ref 4 miR-30a inhibits endothelin A receptor and chemoresistance in ovarian carcinoma. Oncotarget. 2016 Jan 26;7(4):4009-23. doi: 10.18632/oncotarget.6546.
Ref 5 MicroRNA-30a sensitizes tumor cells to cis-platinum via suppressing beclin 1-mediated autophagy. J Biol Chem. 2012 Feb 3;287(6):4148-56. doi: 10.1074/jbc.M111.307405. Epub 2011 Dec 8.
Ref 6 MiR-30a Decreases Multidrug Resistance (MDR) of Gastric Cancer Cells. Med Sci Monit. 2016 Nov 23;0:0.
Ref 7 miRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat. 2012 Jan;131(2):445-54. doi: 10.1007/s10549-011-1424-3. Epub 2011 Mar 12.
Ref 8 MicroRNA-30a downregulation contributes to chemoresistance of osteosarcoma cells through activating Beclin-1-mediated autophagy. Oncol Rep. 2016 Mar;35(3):1757-63. doi: 10.3892/or.2015.4497. Epub 2015 Dec 18.
Ref 9 MiR-30a regulates cancer cell response to chemotherapy through SNAI1/IRS1/AKT pathway. Cell Death Dis. 2019 Feb 15;10(3):153. doi: 10.1038/s41419-019-1326-6.
Ref 10 Targeting microRNA-30a-mediated autophagy enhances imatinib activity against human chronic myeloid leukemia cells. Leukemia. 2012 Aug;26(8):1752-60. doi: 10.1038/leu.2012.65. Epub 2012 Mar 7.
Ref 11 microRNA 30A promotes autophagy in response to cancer therapy. Autophagy. 2012 May 1;8(5):853-5. doi: 10.4161/auto.20053. Epub 2012 May 1.
Ref 12 MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) expression. J Biol Chem. 2010 Jul 9;285(28):21496-507. doi: 10.1074/jbc.M109.083337. Epub 2010 May 11.
Ref 13 The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.