General Information of the Molecule (ID: Mol01351)
Name
hsa-mir-29a ,Homo sapiens
Synonyms
microRNA 29a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR29A
Gene ID
407021
Location
chr7:130876747-130876810[-]
Sequence
AUGACUGAUUUCUUUUGGUGUUCAGAGUCAAUAUAAUUUUCUAGCACCAUCUGAAAUCGG
UUAU
    Click to Show/Hide
Ensembl ID
ENSG00000284032
HGNC ID
HGNC:31616
Precursor Accession
MI0000087
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Oral squamous cell carcinoma [1]
Resistant Disease Oral squamous cell carcinoma [ICD-11: 2B6E.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model SCC25 cells Oral Homo sapiens (Human) CVCL_1682
SCC4 cells Tongue Homo sapiens (Human) CVCL_1684
SCC9 cells Tongue Homo sapiens (Human) CVCL_1685
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-29a expression was decreased in clinical OSCC cancer specimens. miR-29a negatively regulated MMP2 transcription and translation through directly binding to 3'-UTR. miR-29a overexpression could inhibit OSCC cancer cell invasion and anti-apoptotic ability, and vice versa.
Disease Class: Ovarian cancer [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
CP70 cells Ovary Homo sapiens (Human) CVCL_0135
HeyC2 cells Ovary Homo sapiens (Human) CVCL_X009
In Vivo Model NOD/SCID nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Knockdown of miR-29a/b/c increased the ability of cells to escape cisplatin-induced cell death partly through upregulation of collagen type I alpha 1 (COL1A1) and increased the activation of extracellular signal-regulated kinase 1/2 and inactivation of glycogen synthase kinase 3 beta.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1650 cells Lung Homo sapiens (Human) CVCL_1483
HEK293 FT cells Kidney Homo sapiens (Human) CVCL_6911
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description microRNA 29a enhances cisplatin sensitivity in non small cell lung cancer through the downregulation of REV3L.
Disease Class: Lung cancer [4]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay; Caspase-3 Activity Assay
Mechanism Description miR-29a renders lung cancer cells more sensitive to cisplatin treatment and miR-29a and cisplatin combination promoted apoptotic effect through targeting NRAS in lung cancer cells.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [5]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description PTEN plays major roles in suppressing cancer and embryonic development, cell migration and apoptosis, miR-222 and -29a could regulate the expression of PTEN, maybe through which the two miRNAs conferred Adr and Doc resistance in MCF-7 cells.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [5]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description PTEN plays major roles in suppressing cancer and embryonic development, cell migration and apoptosis, miR-222 and -29a could regulate the expression of PTEN, maybe through which the two miRNAs conferred Adr and Doc resistance in MCF-7 cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [6]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
PTEN/AKT/GSk3Beta signaling pathway Activation hsa05235
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTS assay; Flow cytometry assay
Mechanism Description Down-regulation of miR-29a expression in MCF-7/ADR cells increased PTEN expression levels, resulting in decreased phospho-Akt (p-Akt) and phospho-GSk3beta (p-GSk3beta) expression. Conversely, upregulation of miR-29a expression in MCF-7/S cells is associated with decreasing PTEN expression and increasing p-Akt and p-GSk3beta expression. PTEN and GSk3beta are targeted by miR-29a, and miR-29a may contribute to ADR resistance through inhibition of the PTEN/AkT/GSk3beta pathway in breast cancer cells.
Fludarabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [7]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Fludarabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation p53 signaling pathway Inhibition hsa04115
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-29a can activate p53 and induce apoptosis in a p53-dependent manner.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [8]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
Wnt/Beta-catenin signaling pathway Inhibition hsa04310
In Vitro Model BxPC-3 cells Pancreas Homo sapiens (Human) CVCL_0186
MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
PSN1 cells Pancreas Homo sapiens (Human) CVCL_1644
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Our findings suggest that miR-29a expression correlates significantly with the growth-inhibitory effect of GEM and that activation of the Wnt/beta-catenin signaling pathway mediated the miR-29a-induced resistance to GEM in pancreatic cancer cell lines.
Methotrexate
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [9]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Methotrexate
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Overexpression of miR-29a suppressed MTX resistance and promoted cell apoptosis by downregulating MCL1 expression.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Nasopharyngeal carcinoma [10]
Resistant Disease Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
JAKT/STAT signaling pathway Regulation hsa04630
Tumorigenesis Activation hsa05206
In Vitro Model NP69 cells Nasopharynx Homo sapiens (Human) CVCL_F755
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description miR-29a down-regulation is correlated with drug resistance of nasopharyngeal carcinoma cell line CNE-1 and miR-29a up-regulation decreases Taxol resistance of nasopharyngeal carcinoma CNE-1 cells possibly via inhibiting STAT3 and Bcl-2 expression.
References
Ref 1 MicroRNA-29a upregulates MMP2 in oral squamous cell carcinoma to promote cancer invasion and anti-apoptosis. Biomed Pharmacother. 2014 Feb;68(1):13-9. doi: 10.1016/j.biopha.2013.10.005. Epub 2013 Oct 18.
Ref 2 Downregulation of miR-29 contributes to cisplatin resistance of ovarian cancer cells. Int J Cancer. 2014 Feb 1;134(3):542-51. doi: 10.1002/ijc.28399. Epub 2013 Aug 28.
Ref 3 MicroRNA 29a enhances cisplatin sensitivity in non small cell lung cancer through the regulation of REV3L. Mol Med Rep. 2019 Feb;19(2):831-840. doi: 10.3892/mmr.2018.9723. Epub 2018 Dec 4.
Ref 4 MicroRNA-29a Functions as a Tumor Suppressor and Increases Cisplatin Sensitivity by Targeting NRAS in Lung Cancer. Technol Cancer Res Treat. 2018 Jan 1;17:1533033818758905. doi: 10.1177/1533033818758905.
Ref 5 MiR-222 and miR-29a contribute to the drug-resistance of breast cancer cells. Gene. 2013 Nov 15;531(1):8-14. doi: 10.1016/j.gene.2013.08.062. Epub 2013 Aug 29.
Ref 6 MicroRNA-29a contributes to drug-resistance of breast cancer cells to adriamycin through PTEN/AKT/GSK3Beta signaling pathway. Gene. 2016 Nov 15;593(1):84-90. doi: 10.1016/j.gene.2016.08.016. Epub 2016 Aug 11.
Ref 7 Determination of genes and microRNAs involved in the resistance to fludarabine in vivo in chronic lymphocytic leukemia. Mol Cancer. 2010 May 20;9:115. doi: 10.1186/1476-4598-9-115.
Ref 8 MicroRNA-29a induces resistance to gemcitabine through the Wnt/Beta-catenin signaling pathway in pancreatic cancer cells. Int J Oncol. 2013 Oct;43(4):1066-72. doi: 10.3892/ijo.2013.2037. Epub 2013 Jul 24.
Ref 9 miR-29 Family Inhibits Resistance to Methotrexate and Promotes Cell Apoptosis by Targeting COL3A1 and MCL1 in Osteosarcoma. Med Sci Monit. 2018 Dec 6;24:8812-8821. doi: 10.12659/MSM.911972.
Ref 10 Targeted regulationof STAT3 by miR-29a in mediating Taxol resistance of nasopharyngeal carcinoma cell line CNE-1. Cancer Biomark. 2018;22(4):641-648. doi: 10.3233/CBM-170964.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.