General Information of the Molecule (ID: Mol01341)
Name
hsa-mir-19b ,Homo sapiens
Synonyms
microRNA 19b-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR19B1
Gene ID
406980
Location
chr13:91351192-91351278[+]
Sequence
CACUGUUCUAUGGUUAGUUUUGCAGGUUUGCAUCCAGCUGUGUGAUAUUCUGCUGUGCAA
AUCCAUGCAAAACUGACUGUGGUAGUG
    Click to Show/Hide
Ensembl ID
ENSG00000284375
HGNC ID
HGNC:31575
Precursor Accession
MI0000074
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PTEN/AKT signaling pathway Inhibition hsa05235
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PTEN/AKT signaling pathway Inhibition hsa05235
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PTEN/AKT signaling pathway Inhibition hsa05235
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.
Disease Class: Colon cancer [2]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model DLD1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-19b and miR-21 were over-expressed in 5-FU-resistant cells. Ingenuity pathway analysis of mRNA targets significantly (P < 0.05) indicated the category "Cell Cycle" as a probable area of the molecular and cellular function related with 5-FU resistance. Among candidate mRNA targets, SFPQ and MYBL2 have been linked to cell cycle functions.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PTEN/AKT signaling pathway Inhibition hsa05235
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
SGC7901/ADR cells Gastric Homo sapiens (Human) CVCL_VU57
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-19a/b are upregulated in multidrug-resistant gastric cancer cell line, miR-19a/b suppress the sensitivity of gastric cancer cells to anticancer drugs, miR-19a/b accelerate the efflux of ADR through P-gp upregulation.
References
Ref 1 MicroRNA-19a/b regulates multidrug resistance in human gastric cancer cells by targeting PTEN. Biochem Biophys Res Commun. 2013 May 10;434(3):688-94. doi: 10.1016/j.bbrc.2013.04.010. Epub 2013 Apr 16.
Ref 2 Role of miR-19b and its target mRNAs in 5-fluorouracil resistance in colon cancer cells. J Gastroenterol. 2012 Aug;47(8):883-95. doi: 10.1007/s00535-012-0547-6. Epub 2012 Mar 1.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.