Molecule Information
General Information of the Molecule (ID: Mol01339)
Name |
hsa-mir-18a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 18a
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR18A
|
||||
Gene ID | |||||
Location |
chr13:91350751-91350821[+]
|
||||
Sequence |
UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGC
UCCUUCUGGCA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
Cell viability | Inhibition | hsa05200 | ||
miR18a/PTEN signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | TP53TG1 increased the sensitivity of NSCLC cells to cisplatin by modulating miR-18a/PTEN axis by promoting PTEN expression via inhibiting miR-18a. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [2] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR-18a is an important miRNA that suppresses Dicer expression and increases paclitaxel resistance in triple-negative breast cancer cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [3] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Tamoxifen | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
BT474 cells | Breast | Homo sapiens (Human) | CVCL_0179 | |
LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
LCC9 cells | Breast | Homo sapiens (Human) | CVCL_DP52 | |
Experiment for Molecule Alteration |
qRT-PCR; Dual luciferase assay | |||
Experiment for Drug Resistance |
CCK8 assay; Soft agar assay; Flow cytometric analysis | |||
Mechanism Description | Long non-coding RNA UCA1 enhances tamoxifen resistance in breast cancer cells through a miR18a-HIF1alpha feedback regulatory loop. The upregulated UCA1 sponges miR18a, which is a negative regulator of HIF1alpha. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [4] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Trastuzumab | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay; Matrigel Invasion assay | |||
Mechanism Description | UCA1 knockdown upregulated miR-18a and downregulated YAP1 in breast cancer cells, restoring sensitivity of breast cancer cells to trastuzumab. |
Clinical Trial Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [5] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Oncolytic vaccinia virus | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | CaCo2 cells | Colon | Homo sapiens (Human) | CVCL_0025 |
HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
Virus binding and entry assays | |||
Mechanism Description | Long noncoding RNA UCA1 enhances sensitivity to oncolytic vaccinia virus by sponging miR-18a/miR-182 and modulating the Cdc42/filopodia axis in colorectal cancer. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.