General Information of the Molecule (ID: Mol01339)
Name
hsa-mir-18a ,Homo sapiens
Synonyms
microRNA 18a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR18A
Gene ID
406953
Location
chr13:91350751-91350821[+]
Sequence
UGUUCUAAGGUGCAUCUAGUGCAGAUAGUGAAGUAGAUUAGCAUCUACUGCCCUAAGUGC
UCCUUCUGGCA
    Click to Show/Hide
Ensembl ID
ENSG00000283815
HGNC ID
HGNC:31548
Precursor Accession
MI0000072
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
miR18a/PTEN signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description TP53TG1 increased the sensitivity of NSCLC cells to cisplatin by modulating miR-18a/PTEN axis by promoting PTEN expression via inhibiting miR-18a.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-18a is an important miRNA that suppresses Dicer expression and increases paclitaxel resistance in triple-negative breast cancer cells.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
BT474 cells Breast Homo sapiens (Human) CVCL_0179
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
LCC9 cells Breast Homo sapiens (Human) CVCL_DP52
Experiment for
Molecule Alteration
qRT-PCR; Dual luciferase assay
Experiment for
Drug Resistance
CCK8 assay; Soft agar assay; Flow cytometric analysis
Mechanism Description Long non-coding RNA UCA1 enhances tamoxifen resistance in breast cancer cells through a miR18a-HIF1alpha feedback regulatory loop. The upregulated UCA1 sponges miR18a, which is a negative regulator of HIF1alpha.
Trastuzumab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [4]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Trastuzumab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell viability Inhibition hsa05200
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay; Matrigel Invasion assay
Mechanism Description UCA1 knockdown upregulated miR-18a and downregulated YAP1 in breast cancer cells, restoring sensitivity of breast cancer cells to trastuzumab.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Oncolytic vaccinia virus
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [5]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Oncolytic vaccinia virus
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
Virus binding and entry assays
Mechanism Description Long noncoding RNA UCA1 enhances sensitivity to oncolytic vaccinia virus by sponging miR-18a/miR-182 and modulating the Cdc42/filopodia axis in colorectal cancer.
References
Ref 1 TP53TG1 enhances cisplatin sensitivity of non-small cell lung cancer cells through regulating miR-18a/PTEN axis. Cell Biosci. 2018 Mar 22;8:23. doi: 10.1186/s13578-018-0221-7. eCollection 2018.
Ref 2 MiR-18a upregulation decreases Dicer expression and confers paclitaxel resistance in triple negative breast cancer. Eur Rev Med Pharmacol Sci. 2016 Jun;20(11):2201-8.
Ref 3 [Urothelial carcinoma-associated 1 enhances tamoxifen resistance in breast cancer cells through competitively inhibiting miR-18a]. Beijing Da Xue Xue Bao Yi Xue Ban. 2017 Apr 18;49(2):295-302.
Ref 4 Long non-coding RNA UCA1 desensitizes breast cancer cells to trastuzumab by impeding miR-18a repression of Yes-associated protein 1. Biochem Biophys Res Commun. 2018 Feb 19;496(4):1308-1313. doi: 10.1016/j.bbrc.2018.02.006. Epub 2018 Feb 7.
Ref 5 Long noncoding RNA UCA1 enhances sensitivity to oncolytic vaccinia virus by sponging miR-18a/miR-182 and modulating the Cdc42/filopodia axis in colorectal cancer. Biochem Biophys Res Commun. 2019 Aug 27;516(3):831-838. doi: 10.1016/j.bbrc.2019.06.125. Epub 2019 Jun 28.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.