General Information of the Molecule (ID: Mol01336)
Name
hsa-mir-16 ,Homo sapiens
Synonyms
microRNA 16-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR16-1
Gene ID
406950
Location
chr13:50048973-50049061[-]
Sequence
GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGU
AUUAACUGUGCUGCUGAAGUAAGGUUGAC
    Click to Show/Hide
Ensembl ID
ENSG00000208006
HGNC ID
HGNC:31545
Precursor Accession
MI0000070
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
11 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [1]
Resistant Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
SYBR Green-based assay
Mechanism Description Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.
Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [1]
Resistant Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
SYBR Green-based assay
Mechanism Description Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Epidermoid carcinoma [ICD-11: 2C31.Z] [2]
Sensitive Disease Epidermoid carcinoma [ICD-11: 2C31.Z]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model KB-3-1 cells Lung Homo sapiens (Human) CVCL_2088
KB-CP.5 cells Lung Homo sapiens (Human) CVCL_IP04
KB-CP20 cells Lung Homo sapiens (Human) CVCL_IP06
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.
Dexamethasone
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Multiple myeloma [ICD-11: 2A83.0] [4]
Resistant Disease Multiple myeloma [ICD-11: 2A83.0]
Resistant Drug Dexamethasone
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description microRNA-15a and -16 expressions tightly correlated with proliferation and drug sensitivity of MM cells. miRNA-15a/-16 expression in MM cells was significantly increased after treatment with cytotoxic agents. The interaction of bone marrow stromal cells (BMSC) with MM cells resulted in decreased miRNA-15a/-16 expression and promoted the survival of the MM cells.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [5]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/AR cells Gastric Homo sapiens (Human) CVCL_VU57
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Transwell invasion assay; CCK8 assay
Mechanism Description The expression of miR16-1 was positively related with the chemosensitivity of GC to adriamycin, and miR16-1 could targeted silence FUBP1 to advance the chemosensitivity to adriamycin in GC.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [6]
Sensitive Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MET-5A cells Lung Homo sapiens (Human) CVCL_3749
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Colony formation assay
Mechanism Description Growth inhibition caused by miR-16 correlated with downregulation of target genes including Bcl-2 and CCND1, and miR-16 re-expression sensitised MPM cells to pemetrexed and gemcitabine.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [7]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Imatinib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description LncRNA UCA1 Contributes to Imatinib Resistance by Acting as a ceRNA Against miR16 in Chronic Myeloid Leukemia Cells. UCA1 directly interacts with miR16.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [8]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
NF-kappaB signaling pathway Activation hsa04064
In Vitro Model BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
HCCLM3 cells Liver Homo sapiens (Human) CVCL_6832
BEL-7404 cells Liver Homo sapiens (Human) CVCL_6568
SMMC7721 cells Uterus Homo sapiens (Human) CVCL_0534
PLC cells Liver Homo sapiens (Human) CVCL_0485
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Silencing the expression of miR-16 induced the chemoresistance in HCC by target IkBkB via NF-kB signaling pathway.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [9]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
NF-kappaB signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Ectopic expression of miR-16 promoted Taxol-induced cytotoxicity and apoptosis in breast cancer cells. Furthermore, IkBkB was identified to be a direct target of miR-16, restoring the expression of IkBkB counteracted miR-16-mediated Taxol sensitivity. Moreover, miR-16 was highly expressed in Taxol-sensitive breast cancer patients and negatively associated with T stages, whereas IkBkB was lowly expressed in Taxol-sensitive breast cancer and positively correlated with T, N and clinical stages.
Disease Class: Lung cancer [ICD-11: 2C25.5] [10]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
PI3K/AKT/mTOR signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCl-H596 cells Lung Homo sapiens (Human) CVCL_1571
NCI-H1734 cells Lung Homo sapiens (Human) CVCL_1491
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-16 was also significantly downregulated in paclitaxel resistant lung cancer cells. anti-apoptotic protein Bcl-2 was directly targeted miR-16 in paclitaxel resistant lung cancer cells. the combined overexpression of miR-16 and miR-17 and subsequent paclitaxel treatment greatly sensitized paclitaxel resistant lung cancer cells to paclitaxel by inducing apoptosis via caspase-3 mediated pathway. Combined overexpression of miR-16 and miR-17 greatly reduced Beclin-1 and Bcl-2 expressions respectively. though miR-17 and miR-16 had no common target, both miR-16 and miR-17 jointly played roles in the development of paclitaxel resistance in lung cancer. miR-17 overexpression reduced cytoprotective autophagy by targeting Beclin-1, whereas overexpression of miR-16 potentiated paclitaxel induced apoptotic cell death by inhibiting anti-apoptotic protein Bcl-2.
Pemetrexed
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [6]
Sensitive Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
Sensitive Drug Pemetrexed
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MET-5A cells Lung Homo sapiens (Human) CVCL_3749
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Colony formation assay
Mechanism Description Growth inhibition caused by miR-16 correlated with downregulation of target genes including Bcl-2 and CCND1, and miR-16 re-expression sensitised MPM cells to pemetrexed and gemcitabine.
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [11]
Resistant Disease Glioma [ICD-11: 2A00.1]
Resistant Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model A172 cells Brain Homo sapiens (Human) CVCL_0131
U138-MG cells Brain Homo sapiens (Human) CVCL_0020
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description The mechanism responsible for resistance of glioma cells to temozolomide was associated with miR-16-mediated downregulation of Bcl-2. miR-16 may function as an important modifier of the response of glioma cells to temozolomide.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [12]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model HCT8 cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-15a and Mir-16 reverse drug resistance in colon cancer cells, possibly by down-regulating the expression of Bcl-2 protein.
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Vincristine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.
Vinorelbine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [1]
Resistant Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
Resistant Drug Vinorelbine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
SYBR Green-based assay
Mechanism Description Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.
Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [1]
Resistant Disease Malignant pleural mesothelioma [ICD-11: 2C26.0]
Resistant Drug Vinorelbine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MSTO-211H cells Lung Homo sapiens (Human) CVCL_1430
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
SYBR Green-based assay
Mechanism Description Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only.
References
Ref 1 Tumour suppressor microRNAs contribute to drug resistance in malignant pleural mesothelioma by targeting anti-apoptotic pathways .Cancer Drug Resist. 2019 Dec 19;2(4):1193-1206. doi: 10.20517/cdr.2019.41. eCollection 2019. 10.20517/cdr.2019.41
Ref 2 Cisplatin sensitivity mediated by WEE1 and CHK1 is mediated by miR-155 and the miR-15 family. Cancer Res. 2012 Nov 15;72(22):5945-55. doi: 10.1158/0008-5472.CAN-12-1400. Epub 2012 Aug 31.
Ref 3 miR-15b and miR-16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells. Int J Cancer. 2008 Jul 15;123(2):372-379. doi: 10.1002/ijc.23501.
Ref 4 Suppressing miRNA-15a/-16 expression by interleukin-6 enhances drug-resistance in myeloma cells. J Hematol Oncol. 2011 Sep 22;4:37. doi: 10.1186/1756-8722-4-37.
Ref 5 MiR-16-1 Targeted Silences Far Upstream Element Binding Protein 1 to Advance the Chemosensitivity to Adriamycin in Gastric Cancer. Pathol Oncol Res. 2018 Jul;24(3):483-488. doi: 10.1007/s12253-017-0263-x. Epub 2017 Jun 30.
Ref 6 Restoring expression of miR-16: a novel approach to therapy for malignant pleural mesothelioma. Ann Oncol. 2013 Dec;24(12):3128-35. doi: 10.1093/annonc/mdt412. Epub 2013 Oct 22.
Ref 7 lncRNA UCA1 Contributes to Imatinib Resistance by Acting as a ceRNA Against miR-16 in Chronic Myeloid Leukemia Cells. DNA Cell Biol. 2017 Jan;36(1):18-25. doi: 10.1089/dna.2016.3533. Epub 2016 Nov 17.
Ref 8 Inhibition of microRNA-16 facilitates the paclitaxel resistance by targeting IKBKB via NF-kB signaling pathway in hepatocellular carcinoma. Biochem Biophys Res Commun. 2018 Sep 5;503(2):1035-1041. doi: 10.1016/j.bbrc.2018.06.113. Epub 2018 Aug 2.
Ref 9 MicroRNA-16 sensitizes breast cancer cells to paclitaxel through suppression of IKBKB expression. Oncotarget. 2016 Apr 26;7(17):23668-83. doi: 10.18632/oncotarget.8056.
Ref 10 MiR-16 targets Bcl-2 in paclitaxel-resistant lung cancer cells and overexpression of miR-16 along with miR-17 causes unprecedented sensitivity by simultaneously modulating autophagy and apoptosis. Cell Signal. 2015 Feb;27(2):189-203. doi: 10.1016/j.cellsig.2014.11.023. Epub 2014 Nov 27.
Ref 11 MiR-16 modulate temozolomide resistance by regulating BCL-2 in human glioma cells. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12698-707. eCollection 2015.
Ref 12 [miR-15a and miR-16 modulate drug resistance by targeting bcl-2 in human colon cancer cells]. Zhonghua Zhong Liu Za Zhi. 2014 Dec;36(12):897-902.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.