Molecule Information
General Information of the Molecule (ID: Mol01336)
| Name |
hsa-mir-16
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 16-1
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR16-1
|
||||
| Gene ID | |||||
| Location |
chr13:50048973-50049061[-]
|
||||
| Sequence |
GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGU
AUUAACUGUGCUGCUGAAGUAAGGUUGAC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
11 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] | [1] | |||
| Resistant Disease | Malignant pleural mesothelioma [ICD-11: 2C26.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MSTO-211H cells | Lung | Homo sapiens (Human) | CVCL_1430 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
SYBR Green-based assay | |||
| Mechanism Description | Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only. | |||
| Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] | [1] | |||
| Resistant Disease | Malignant pleural mesothelioma [ICD-11: 2C26.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MSTO-211H cells | Lung | Homo sapiens (Human) | CVCL_1430 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
SYBR Green-based assay | |||
| Mechanism Description | Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Epidermoid carcinoma [ICD-11: 2C31.Z] | [2] | |||
| Sensitive Disease | Epidermoid carcinoma [ICD-11: 2C31.Z] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | KB-3-1 cells | Lung | Homo sapiens (Human) | CVCL_2088 |
| KB-CP.5 cells | Lung | Homo sapiens (Human) | CVCL_IP04 | |
| KB-CP20 cells | Lung | Homo sapiens (Human) | CVCL_IP06 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [3] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Mitochondrial signaling pathway | Activation | hsa04217 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Multiple myeloma [ICD-11: 2A83.0] | [4] | |||
| Resistant Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
| Resistant Drug | Dexamethasone | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | microRNA-15a and -16 expressions tightly correlated with proliferation and drug sensitivity of MM cells. miRNA-15a/-16 expression in MM cells was significantly increased after treatment with cytotoxic agents. The interaction of bone marrow stromal cells (BMSC) with MM cells resulted in decreased miRNA-15a/-16 expression and promoted the survival of the MM cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [5] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/AR cells | Gastric | Homo sapiens (Human) | CVCL_VU57 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Transwell invasion assay; CCK8 assay | |||
| Mechanism Description | The expression of miR16-1 was positively related with the chemosensitivity of GC to adriamycin, and miR16-1 could targeted silence FUBP1 to advance the chemosensitivity to adriamycin in GC. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [3] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Mitochondrial signaling pathway | Activation | hsa04217 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [3] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Mitochondrial signaling pathway | Activation | hsa04217 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] | [6] | |||
| Sensitive Disease | Malignant pleural mesothelioma [ICD-11: 2C26.0] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MET-5A cells | Lung | Homo sapiens (Human) | CVCL_3749 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay | |||
| Mechanism Description | Growth inhibition caused by miR-16 correlated with downregulation of target genes including Bcl-2 and CCND1, and miR-16 re-expression sensitised MPM cells to pemetrexed and gemcitabine. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [7] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | LncRNA UCA1 Contributes to Imatinib Resistance by Acting as a ceRNA Against miR16 in Chronic Myeloid Leukemia Cells. UCA1 directly interacts with miR16. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [8] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
| NF-kappaB signaling pathway | Activation | hsa04064 | ||
| In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| HCCLM3 cells | Liver | Homo sapiens (Human) | CVCL_6832 | |
| BEL-7404 cells | Liver | Homo sapiens (Human) | CVCL_6568 | |
| SMMC7721 cells | Uterus | Homo sapiens (Human) | CVCL_0534 | |
| PLC cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Silencing the expression of miR-16 induced the chemoresistance in HCC by target IkBkB via NF-kB signaling pathway. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [9] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| NF-kappaB signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Ectopic expression of miR-16 promoted Taxol-induced cytotoxicity and apoptosis in breast cancer cells. Furthermore, IkBkB was identified to be a direct target of miR-16, restoring the expression of IkBkB counteracted miR-16-mediated Taxol sensitivity. Moreover, miR-16 was highly expressed in Taxol-sensitive breast cancer patients and negatively associated with T stages, whereas IkBkB was lowly expressed in Taxol-sensitive breast cancer and positively correlated with T, N and clinical stages. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [10] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| PI3K/AKT/mTOR signaling pathway | Regulation | N.A. | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| NCl-H596 cells | Lung | Homo sapiens (Human) | CVCL_1571 | |
| NCI-H1734 cells | Lung | Homo sapiens (Human) | CVCL_1491 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-16 was also significantly downregulated in paclitaxel resistant lung cancer cells. anti-apoptotic protein Bcl-2 was directly targeted miR-16 in paclitaxel resistant lung cancer cells. the combined overexpression of miR-16 and miR-17 and subsequent paclitaxel treatment greatly sensitized paclitaxel resistant lung cancer cells to paclitaxel by inducing apoptosis via caspase-3 mediated pathway. Combined overexpression of miR-16 and miR-17 greatly reduced Beclin-1 and Bcl-2 expressions respectively. though miR-17 and miR-16 had no common target, both miR-16 and miR-17 jointly played roles in the development of paclitaxel resistance in lung cancer. miR-17 overexpression reduced cytoprotective autophagy by targeting Beclin-1, whereas overexpression of miR-16 potentiated paclitaxel induced apoptotic cell death by inhibiting anti-apoptotic protein Bcl-2. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] | [6] | |||
| Sensitive Disease | Malignant pleural mesothelioma [ICD-11: 2C26.0] | |||
| Sensitive Drug | Pemetrexed | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MET-5A cells | Lung | Homo sapiens (Human) | CVCL_3749 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay | |||
| Mechanism Description | Growth inhibition caused by miR-16 correlated with downregulation of target genes including Bcl-2 and CCND1, and miR-16 re-expression sensitised MPM cells to pemetrexed and gemcitabine. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioma [ICD-11: 2A00.1] | [11] | |||
| Resistant Disease | Glioma [ICD-11: 2A00.1] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | A172 cells | Brain | Homo sapiens (Human) | CVCL_0131 |
| U138-MG cells | Brain | Homo sapiens (Human) | CVCL_0020 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | The mechanism responsible for resistance of glioma cells to temozolomide was associated with miR-16-mediated downregulation of Bcl-2. miR-16 may function as an important modifier of the response of glioma cells to temozolomide. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [12] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-15a and Mir-16 reverse drug resistance in colon cancer cells, possibly by down-regulating the expression of Bcl-2 protein. | |||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [3] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Mitochondrial signaling pathway | Activation | hsa04217 | ||
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] | [1] | |||
| Resistant Disease | Malignant pleural mesothelioma [ICD-11: 2C26.0] | |||
| Resistant Drug | Vinorelbine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MSTO-211H cells | Lung | Homo sapiens (Human) | CVCL_1430 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
SYBR Green-based assay | |||
| Mechanism Description | Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only. | |||
| Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] | [1] | |||
| Resistant Disease | Malignant pleural mesothelioma [ICD-11: 2C26.0] | |||
| Resistant Drug | Vinorelbine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MSTO-211H cells | Lung | Homo sapiens (Human) | CVCL_1430 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
SYBR Green-based assay | |||
| Mechanism Description | Expression of miR-15a, miR-16 and miR-34a was downregulated in MPM cells with acquired drug resistance. Transfection with miR-15a or miR-16 mimics reversed the resistance to cisplatin, gemcitabine or vinorelbine, whereas miR-34a reversed cisplatin and vinorelbine resistance only. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
