Molecule Information

General Information of the Molecule (ID: Mol01331)

Name	hsa-let-7d ,Homo sapiens
Synonyms	microRNA let-7d Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIRLET7D
Gene ID	406886
Location	chr9:94178834-94178920[+]
Sequence	CCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUA ACUAUACGACCUGCUGCCUUUCUUAGG Click to Show/Hide
Ensembl ID	ENSG00000199133
HGNC ID	HGNC:31481
Precursor Accession	MI0000065
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s)

5 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1]				[1]
Sensitive Disease	Head and neck squamous cell carcinoma [ICD-11: 2D42.1]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	293T cells	Breast	Homo sapiens (Human)	CVCL_0063
	FaDu cells	Pharynx	Homo sapiens (Human)	CVCL_1218
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Clonogenic assay; MTT assay
Mechanism Description	The level of let-7d expression is an important factor for cell response to irradiation and chemotherapeutics. Overexpressed let-7d inhibited chemoresistance to cisplatin and paclitaxel in OSCC-ALDH1+ cells.

Doxorubicin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1]				[1]
Sensitive Disease	Head and neck squamous cell carcinoma [ICD-11: 2D42.1]			Disease Info
Sensitive Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	293T cells	Breast	Homo sapiens (Human)	CVCL_0063
	FaDu cells	Pharynx	Homo sapiens (Human)	CVCL_1218
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Clonogenic assay; MTT assay
Mechanism Description	The level of let-7d expression is an important factor for cell response to irradiation and chemotherapeutics. Overexpressed let-7d inhibited chemoresistance to cisplatin and paclitaxel in OSCC-ALDH1+ cells.

Fluorouracil

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1]				[1]
Sensitive Disease	Head and neck squamous cell carcinoma [ICD-11: 2D42.1]			Disease Info
Sensitive Drug	Fluorouracil			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	293T cells	Breast	Homo sapiens (Human)	CVCL_0063
	FaDu cells	Pharynx	Homo sapiens (Human)	CVCL_1218
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Clonogenic assay; MTT assay
Mechanism Description	The level of let-7d expression is an important factor for cell response to irradiation and chemotherapeutics. Overexpressed let-7d inhibited chemoresistance to cisplatin and paclitaxel in OSCC-ALDH1+ cells.

Gemcitabine

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Regulation by the Disease Microenvironment (RTDM)			Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3]				[2]
Sensitive Disease	Pancreatic cancer [ICD-11: 2C10.3]			Disease Info
Sensitive Drug	Gemcitabine			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MIA PaCa-2 cells	Pancreas	Homo sapiens (Human)	CVCL_0428
	PANC-1 cells	Pancreas	Homo sapiens (Human)	CVCL_0480
	AsPC-1 cells	Pancreas	Homo sapiens (Human)	CVCL_0152
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	WST-1 assay
Mechanism Description	The expression of miR-200b, miR-200c, let-7b, let-7c, let-7d, and let-7e was significantly down-regulated in gemcitabine-resistant cells that showed EMT characteristics such as elongated fibroblastoid morphology, lower expression of epithelial marker E-cadherin, and higher expression of mesenchymal markers such as vimentin and ZEB1.

Paclitaxel

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1]				[1]
Sensitive Disease	Head and neck squamous cell carcinoma [ICD-11: 2D42.1]			Disease Info
Sensitive Drug	Paclitaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	293T cells	Breast	Homo sapiens (Human)	CVCL_0063
	FaDu cells	Pharynx	Homo sapiens (Human)	CVCL_1218
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	Clonogenic assay; MTT assay
Mechanism Description	The level of let-7d expression is an important factor for cell response to irradiation and chemotherapeutics. Overexpressed let-7d inhibited chemoresistance to cisplatin and paclitaxel in OSCC-ALDH1+ cells.

References

Ref 1	Different levels of let-7d expression modulate response of FaDu cells to irradiation and chemotherapeutics. PLoS One. 2017 Jun 30;12(6):e0180265. doi: 10.1371/journal.pone.0180265. eCollection 2017.
Ref 2	Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.