General Information of the Molecule (ID: Mol01331)
Name
hsa-let-7d ,Homo sapiens
Synonyms
microRNA let-7d
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIRLET7D
Gene ID
406886
Location
chr9:94178834-94178920[+]
Sequence
CCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUA
ACUAUACGACCUGCUGCCUUUCUUAGG
    Click to Show/Hide
Ensembl ID
ENSG00000199133
HGNC ID
HGNC:31481
Precursor Accession
MI0000065
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1] [1]
Sensitive Disease Head and neck squamous cell carcinoma [ICD-11: 2D42.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model 293T cells Breast Homo sapiens (Human) CVCL_0063
FaDu cells Pharynx Homo sapiens (Human) CVCL_1218
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Clonogenic assay; MTT assay
Mechanism Description The level of let-7d expression is an important factor for cell response to irradiation and chemotherapeutics. Overexpressed let-7d inhibited chemoresistance to cisplatin and paclitaxel in OSCC-ALDH1+ cells.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1] [1]
Sensitive Disease Head and neck squamous cell carcinoma [ICD-11: 2D42.1]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model 293T cells Breast Homo sapiens (Human) CVCL_0063
FaDu cells Pharynx Homo sapiens (Human) CVCL_1218
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Clonogenic assay; MTT assay
Mechanism Description The level of let-7d expression is an important factor for cell response to irradiation and chemotherapeutics. Overexpressed let-7d inhibited chemoresistance to cisplatin and paclitaxel in OSCC-ALDH1+ cells.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1] [1]
Sensitive Disease Head and neck squamous cell carcinoma [ICD-11: 2D42.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model 293T cells Breast Homo sapiens (Human) CVCL_0063
FaDu cells Pharynx Homo sapiens (Human) CVCL_1218
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Clonogenic assay; MTT assay
Mechanism Description The level of let-7d expression is an important factor for cell response to irradiation and chemotherapeutics. Overexpressed let-7d inhibited chemoresistance to cisplatin and paclitaxel in OSCC-ALDH1+ cells.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [2]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
WST-1 assay
Mechanism Description The expression of miR-200b, miR-200c, let-7b, let-7c, let-7d, and let-7e was significantly down-regulated in gemcitabine-resistant cells that showed EMT characteristics such as elongated fibroblastoid morphology, lower expression of epithelial marker E-cadherin, and higher expression of mesenchymal markers such as vimentin and ZEB1.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1] [1]
Sensitive Disease Head and neck squamous cell carcinoma [ICD-11: 2D42.1]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model 293T cells Breast Homo sapiens (Human) CVCL_0063
FaDu cells Pharynx Homo sapiens (Human) CVCL_1218
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Clonogenic assay; MTT assay
Mechanism Description The level of let-7d expression is an important factor for cell response to irradiation and chemotherapeutics. Overexpressed let-7d inhibited chemoresistance to cisplatin and paclitaxel in OSCC-ALDH1+ cells.
References
Ref 1 Different levels of let-7d expression modulate response of FaDu cells to irradiation and chemotherapeutics. PLoS One. 2017 Jun 30;12(6):e0180265. doi: 10.1371/journal.pone.0180265. eCollection 2017.
Ref 2 Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.