Molecule Information

General Information of the Molecule (ID: Mol01330)
Name
hsa-let-7c ,Homo sapiens
Synonyms
microRNA let-7c
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIRLET7C
Gene ID
406885
Location
chr21:16539828-16539911[+]
Sequence
GCAUCCGGGUUGAGGUAGUAGGUUGUAUGGUUUAGAGUUACACCCUGGGAGUUAACUGUA
CAACCUUCUAGCUUUCCUUGGAGC
    Click to Show/Hide
Ensembl ID
ENSG00000199030
HGNC ID
HGNC:31480
Precursor Accession
MI0000064
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
Experiment for
Molecule Alteration		 MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
Experiment for
Drug Resistance		 Cell proliferation assay; Flow cytometry
Mechanism Description We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Oral cancer [ICD-11: 2B6E.1] [2]
Sensitive Disease Oral cancer [ICD-11: 2B6E.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Inhibition hsa05200
In Vitro Model GNM cells Oral Homo sapiens (Human) CVCL_WL58
SAS cells Oral Homo sapiens (Human) CVCL_1675
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The inhibitory effect of let-7c on various stemness phenotypes was reverted by IL-8, indicating that lower expression of let-7c may confer higher cancer stemness through a failure to downregulate IL-8.
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [3]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
IL6/STAT3 signaling signaling pathway Inhibition hsa04659
In Vitro Model TE8 cells Esophageal Homo sapiens (Human) CVCL_1766
TE13 cells Esophageal Homo sapiens (Human) CVCL_4463
TE10 cells Esophagus Homo sapiens (Human) CVCL_1760
TE1 cells Esophagus Homo sapiens (Human) CVCL_1759
TE11 cells Esophagus Homo sapiens (Human) CVCL_1761
TE5 cells Esophagus Homo sapiens (Human) CVCL_1764
TE9 cells Esophagus Homo sapiens (Human) CVCL_1767
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Let-7c directly repressed cisplatin-activated interleukin (IL) -6/STAT3 prosurvival pathway, restored sensitivity to cisplatin and increased rate of apoptosis after exposure to cisplatin.
Daunorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [4]
Resistant Disease Acute lymphocytic leukemia [ICD-11: 2B33.0]
 Disease Info 
Resistant Drug Daunorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Experiment for
Molecule Alteration		 RT-qPCR; RT-PCR
Experiment for
Drug Resistance		 Flow cytometry; MTT assay
Mechanism Description Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [5]
Resistant Disease Lung adenocarcinoma [ICD-11: 2C25.0]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Colony formation assay; Tunel assay
Mechanism Description Long noncoding RNA CCAT1 acts as an oncogene and promotes chemoresistance in docetaxel-resistant lung adenocarcinoma cells.the sponging of let-7c by CCAT1 released Bcl-xl (a let-7c target), thereby promoting the acquisition of chemoresistance and epithelial-to-mesenchymal transition phenotypes in docetaxel-resistant LAD cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [5]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
 Disease Info 
Sensitive Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Colony formation assay; Tunel assay
Mechanism Description Long noncoding RNA CCAT1 acts as an oncogene and promotes chemoresistance in docetaxel-resistant lung adenocarcinoma cells.the sponging of let-7c by CCAT1 released Bcl-xl (a let-7c target), thereby promoting the acquisition of chemoresistance and epithelial-to-mesenchymal transition phenotypes in docetaxel-resistant LAD cells.
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [6]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
 Disease Info 
Sensitive Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Caspase-3 signaling pathway Activation hsa04210
Cell migration Inhibition hsa04670
In Vitro Model SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Ectopic Let-7c expression could increase the sensitivity of docetaxel-resistant LAD cells to chemotherapeutic agents or irradiation and reverse their EMT phenotype by targeting Bcl-xL.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ewing sarcoma [ICD-11: 2B52.0] [7]
Resistant Disease Ewing sarcoma [ICD-11: 2B52.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model VH-64 cells Bones Homo sapiens (Human) CVCL_9672
Sk-N-MC cells Bones Homo sapiens (Human) CVCL_0530
RD-ES cells Bones Homo sapiens (Human) CVCL_2169
Sk-ES cells Bones Homo sapiens (Human) CVCL_0627
TC-71 cells Bones Homo sapiens (Human) CVCL_2213
Experiment for
Molecule Alteration		 qRT-PCR; Western blot
Experiment for
Drug Resistance		 Chemosensitivity assay
Mechanism Description The expression of hsa-let-7c is decreased.
Erlotinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [8]
Sensitive Disease Lung adenocarcinoma [ICD-11: 2C25.0]
 Disease Info 
Sensitive Drug Erlotinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Hedgehog signaling pathway Inhibition hsa04340
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
H1299 cells Lung Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-200b and let-7c, inhibited the TGF-beta1-mediated resistance of NSCLC cells to erlotinib.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [9]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Gefitinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ERK signaling pathway Inhibition hsa04210
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The upregulation of let-7c was associated with the increased gefitinib sensitivity of H1975 cells, and that this effect was mediated by repression of the RAS oncogene and inactivation of the phosphoinositide 3-kinase (PI3k) /AkT and mitogen-activated extracellular signal-regulated kinase (MEk) /extracellular signal-regulated kinase (ERk) signaling pathways.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [10]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
 Disease Info 
Sensitive Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 WST-1 assay
Mechanism Description The expression of miR-200b, miR-200c, let-7b, let-7c, let-7d, and let-7e was significantly down-regulated in gemcitabine-resistant cells that showed EMT characteristics such as elongated fibroblastoid morphology, lower expression of epithelial marker E-cadherin, and higher expression of mesenchymal markers such as vimentin and ZEB1.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
PLX4720
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [11]
Resistant Disease Papillary thyroid carcinoma [ICD-11: 2D10.1]
 Disease Info 
Resistant Drug PLX4720
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration		 Immunoblot analysis; qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description This gene is up-regulated in PLX4720-resistance cells
References
Ref 1 Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
Ref 2 Let-7c restores radiosensitivity and chemosensitivity and impairs stemness in oral cancer cells through inhibiting interleukin-8. J Oral Pathol Med. 2018 Jul;47(6):590-597. doi: 10.1111/jop.12711. Epub 2018 Apr 17.
Ref 3 Let-7 expression is a significant determinant of response to chemotherapy through the regulation of IL-6/STAT3 pathway in esophageal squamous cell carcinoma. Clin Cancer Res. 2012 Sep 15;18(18):5144-53. doi: 10.1158/1078-0432.CCR-12-0701. Epub 2012 Jul 30.
Ref 4 BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
Ref 5 Long noncoding RNA CCAT1 acts as an oncogene and promotes chemoresistance in docetaxel-resistant lung adenocarcinoma cells. Oncotarget. 2016 Sep 20;7(38):62474-62489. doi: 10.18632/oncotarget.11518.
Ref 6 Let-7c governs the acquisition of chemo- or radioresistance and epithelial-to-mesenchymal transition phenotypes in docetaxel-resistant lung adenocarcinoma. Mol Cancer Res. 2013 Jul;11(7):699-713. doi: 10.1158/1541-7786.MCR-13-0019-T. Epub 2013 Apr 5.
Ref 7 VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
Ref 8 Inhibition of Hedgehog signaling sensitizes NSCLC cells to standard therapies through modulation of EMT-regulating miRNAs. J Hematol Oncol. 2013 Oct 7;6(1):77. doi: 10.1186/1756-8722-6-77.
Ref 9 Fulvestrant increases gefitinib sensitivity in non-small cell lung cancer cells by upregulating let-7c expression. Biomed Pharmacother. 2014 Apr;68(3):307-13. doi: 10.1016/j.biopha.2013.10.007. Epub 2013 Nov 7.
Ref 10 Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.
Ref 11 Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.