Molecule Information
General Information of the Molecule (ID: Mol01329)
Name |
hsa-let-7b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA let-7b
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIRLET7B
|
||||
Gene ID | |||||
Location |
chr22:46113686-46113768[+]
|
||||
Sequence |
CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAAC
UAUACAACCUACUGCCUUCCCUG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioblastoma | [1] | |||
Resistant Disease | Glioblastoma [ICD-11: 2A00.02] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell cycle | Inhibition | hsa04110 | ||
Cell viability | Activation | hsa05200 | ||
In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Cisplatin treatment leads to Let-7b suppression, which in turn up-regulates cyclin D1 expression, resulting in resistance to cisplatin. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [2] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | Let-7b increased 5 FU sensitivity by repressing Bcl xl expression in HCC cells. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [3] | |||
Resistant Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Resistant Drug | Gefitinib | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
A549/GR cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis | |||
Mechanism Description | Increased miR17-5p and miR92a expression and decreased let-7b expression can significantly induce proliferation and inhibit apoptosis of lung cancer cells, while reducing lung cancer cell sensitivity to Gefitinib. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: KRAS mutant breast cancer | [4] | |||
Sensitive Disease | KRAS mutant breast cancer [ICD-11: 2C60.10] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
MEK/ERK /PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
NCI-H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors. | |||
Disease Class: kRAS mutant non-small cell lung cancer | [4] | |||
Sensitive Disease | kRAS mutant non-small cell lung cancer [ICD-11: 2C25.9] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
MEK/ERK /PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
NCI-H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors. | |||
Disease Class: KRAS mutant pancreatic ductal adenocarcinoma | [4] | |||
Sensitive Disease | KRAS mutant pancreatic ductal adenocarcinoma [ICD-11: 2C10.5] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
MEK/ERK /PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
NCI-H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors. | |||
|
||||
Disease Class: Pancreatic cancer | [5] | |||
Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Sensitive Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
AsPC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0152 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
WST-1 assay | |||
Mechanism Description | The expression of miR-200b, miR-200c, let-7b, let-7c, let-7d, and let-7e was significantly down-regulated in gemcitabine-resistant cells that showed EMT characteristics such as elongated fibroblastoid morphology, lower expression of epithelial marker E-cadherin, and higher expression of mesenchymal markers such as vimentin and ZEB1. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: KRAS mutant breast cancer | [4] | |||
Sensitive Disease | KRAS mutant breast cancer [ICD-11: 2C60.10] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
MEK/ERK /PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
NCI-H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors. | |||
Disease Class: kRAS mutant non-small cell lung cancer | [4] | |||
Sensitive Disease | kRAS mutant non-small cell lung cancer [ICD-11: 2C25.9] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
MEK/ERK /PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
NCI-H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors. | |||
Disease Class: KRAS mutant pancreatic ductal adenocarcinoma | [4] | |||
Sensitive Disease | KRAS mutant pancreatic ductal adenocarcinoma [ICD-11: 2C10.5] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
MEK/ERK /PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
NCI-H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [6] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Tamoxifen | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | ER-alpha 36 mediated nongenomic estrogen signaling pathway | Activation | hsa04915 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
MDA-MB-436 cells | Breast | Homo sapiens (Human) | CVCL_0623 | |
MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
184A1 cells | Breast | Homo sapiens (Human) | CVCL_3040 | |
HB3396 cells | Breast | Homo sapiens (Human) | N.A. | |
MEGM cells | Breast | Homo sapiens (Human) | N.A. | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Breast cancer patients with tumors highly expressing ER-alpha36 benefit less from tamoxifen treatment. Both mRNA and protein expression of ER-alpha36 were inhibited by let-7 mimics and enhanced by let-7 inhibitors. Our results suggested a novel regulatory mechanism of let-7 miRNAs on ER-alpha36 mediated nongenomic estrogen signal pathways and Tam resistance. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [6] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Tamoxifen | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | ER-alpha 36 mediated nongenomic estrogen signaling pathway | Inhibition | hsa04915 | |
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 | |
MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
MDA-MB-436 cells | Breast | Homo sapiens (Human) | CVCL_0623 | |
MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 | |
184A1 cells | Breast | Homo sapiens (Human) | CVCL_3040 | |
HB3396 cells | Breast | Homo sapiens (Human) | N.A. | |
MEGM cells | Breast | Homo sapiens (Human) | N.A. | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Let-7 miRNAs (b and i) enhanced tamoxifen sensitivity of tamoxifen-resistant breast cancer cells by targeting ER-alpha36 expression. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.