General Information of the Molecule (ID: Mol01329)
Name
hsa-let-7b ,Homo sapiens
Synonyms
microRNA let-7b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIRLET7B
Gene ID
406884
Location
chr22:46113686-46113768[+]
Sequence
CGGGGUGAGGUAGUAGGUUGUGUGGUUUCAGGGCAGUGAUGUUGCCCCUCGGAAGAUAAC
UAUACAACCUACUGCCUUCCCUG
    Click to Show/Hide
Ensembl ID
ENSG00000284520
HGNC ID
HGNC:31479
Precursor Accession
MI0000063
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [ICD-11: 2A00.02] [1]
Resistant Disease Glioblastoma [ICD-11: 2A00.02]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell cycle Inhibition hsa04110
Cell viability Activation hsa05200
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Cisplatin treatment leads to Let-7b suppression, which in turn up-regulates cyclin D1 expression, resulting in resistance to cisplatin.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [2]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Let-7b increased 5 FU sensitivity by repressing Bcl xl expression in HCC cells.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [3]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Gefitinib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
A549/GR cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometric analysis
Mechanism Description Increased miR17-5p and miR92a expression and decreased let-7b expression can significantly induce proliferation and inhibit apoptosis of lung cancer cells, while reducing lung cancer cell sensitivity to Gefitinib.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: KRAS mutant breast cancer [ICD-11: 2C60.10] [4]
Sensitive Disease KRAS mutant breast cancer [ICD-11: 2C60.10]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
MEK/ERK /PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors.
Disease Class: kRAS mutant non-small cell lung cancer [ICD-11: 2C25.9] [4]
Sensitive Disease kRAS mutant non-small cell lung cancer [ICD-11: 2C25.9]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
MEK/ERK /PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors.
Disease Class: KRAS mutant pancreatic ductal adenocarcinoma [ICD-11: 2C10.5] [4]
Sensitive Disease KRAS mutant pancreatic ductal adenocarcinoma [ICD-11: 2C10.5]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
MEK/ERK /PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [5]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
AsPC-1 cells Pancreas Homo sapiens (Human) CVCL_0152
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
WST-1 assay
Mechanism Description The expression of miR-200b, miR-200c, let-7b, let-7c, let-7d, and let-7e was significantly down-regulated in gemcitabine-resistant cells that showed EMT characteristics such as elongated fibroblastoid morphology, lower expression of epithelial marker E-cadherin, and higher expression of mesenchymal markers such as vimentin and ZEB1.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: KRAS mutant breast cancer [ICD-11: 2C60.10] [4]
Sensitive Disease KRAS mutant breast cancer [ICD-11: 2C60.10]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
MEK/ERK /PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors.
Disease Class: kRAS mutant non-small cell lung cancer [ICD-11: 2C25.9] [4]
Sensitive Disease kRAS mutant non-small cell lung cancer [ICD-11: 2C25.9]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
MEK/ERK /PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors.
Disease Class: KRAS mutant pancreatic ductal adenocarcinoma [ICD-11: 2C10.5] [4]
Sensitive Disease KRAS mutant pancreatic ductal adenocarcinoma [ICD-11: 2C10.5]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
MEK/ERK /PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description Let-7b repletion selectively sensitized kRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type kRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEk/ERk and PI3k/AkT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in kRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of beta-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of kRAS mutant tumors.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [6]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ER-alpha 36 mediated nongenomic estrogen signaling pathway Activation hsa04915
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
184A1 cells Breast Homo sapiens (Human) CVCL_3040
HB3396 cells Breast Homo sapiens (Human) N.A.
MEGM cells Breast Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Breast cancer patients with tumors highly expressing ER-alpha36 benefit less from tamoxifen treatment. Both mRNA and protein expression of ER-alpha36 were inhibited by let-7 mimics and enhanced by let-7 inhibitors. Our results suggested a novel regulatory mechanism of let-7 miRNAs on ER-alpha36 mediated nongenomic estrogen signal pathways and Tam resistance.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [6]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation ER-alpha 36 mediated nongenomic estrogen signaling pathway Inhibition hsa04915
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
184A1 cells Breast Homo sapiens (Human) CVCL_3040
HB3396 cells Breast Homo sapiens (Human) N.A.
MEGM cells Breast Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Let-7 miRNAs (b and i) enhanced tamoxifen sensitivity of tamoxifen-resistant breast cancer cells by targeting ER-alpha36 expression.
References
Ref 1 Let-7b expression determines response to chemotherapy through the regulation of cyclin D1 in glioblastoma. J Exp Clin Cancer Res. 2013 Jun 27;32(1):41. doi: 10.1186/1756-9966-32-41.
Ref 2 Let-7b binding site polymorphism in the B-cell lymphoma-extra large 3'UTR is associated with fluorouracil resistance of hepatocellular carcinoma. Mol Med Rep. 2015 Jan;11(1):677-81. doi: 10.3892/mmr.2014.2692. Epub 2014 Oct 17.
Ref 3 The relationship between miR-17-5p, miR-92a, and let-7b expression with non-small cell lung cancer targeted drug resistance. J BUON. 2017 Mar-Apr;22(2):454-461.
Ref 4 Let-7 Sensitizes KRAS Mutant Tumor Cells to Chemotherapy. PLoS One. 2015 May 6;10(5):e0126653. doi: 10.1371/journal.pone.0126653. eCollection 2015.
Ref 5 Up-regulation of miR-200 and let-7 by natural agents leads to the reversal of epithelial-to-mesenchymal transition in gemcitabine-resistant pancreatic cancer cells. Cancer Res. 2009 Aug 15;69(16):6704-12. doi: 10.1158/0008-5472.CAN-09-1298. Epub 2009 Aug 4.
Ref 6 let-7 microRNAs induce tamoxifen sensitivity by downregulation of estrogen receptor Alpha signaling in breast cancer. Mol Med. 2011;17(11-12):1233-41. doi: 10.2119/molmed.2010.00225. Epub 2011 Jul 27.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.