General Information of the Molecule (ID: Mol05772)
Name
hsa-miR-885-3p ,Homo sapiens
Molecule Type
Mature miRNA
Sequence
AGGCAGCGGGGUGUAGUGGAUA
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [1]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Luciferase assay
Experiment for
Drug Resistance
Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is down-regulated in doxorubicin-sensitive cells
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [1]
Sensitive Disease Renal cell carcinoma [ICD-11: 2C90.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Luciferase assay
Experiment for
Drug Resistance
Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is down-regulated in doxorubicin-sensitive cells
References
Ref 1 The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.