Molecule Information

General Information of the Molecule (ID: Mol05710)

• Name: hsa-miR-140-3p ,Homo sapiens
• Molecule Type: Mature miRNA
• Sequence: UACCACAGGGUAGAACCACGG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal carcinoma [ICD-11: 2B70.0] [1]

• Resistant Disease: Esophageal carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: NFYA-MDR1 Axis; Regulation; N.A.
• In Vitro Model: KYSE150 cells; Esophagus; Homo sapiens (Human); CVCL_1348
• In Vitro Model: EC9706 cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: TE1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: It was noticed that the hsa-miRNA-140-3p (miR-140-3p) expression was considerably higher in drug-resistant cells than in sensitive cells. In addition, DGE identified target genes of miR-140-3p might perform key roles in ESCC. Furthermore, this work exhibited that miR-140-3p represents the nuclear transcription factor Y subunit alpha (NFYA) gene by targeting its 3'-untranslated regions. Such an interaction might influence the formation of the transcription factor NFY trimer, which in turn may inhibit the transcription of the multidrug resistance 1 gene and, ultimately, to multidrug resistance in ESCC. The inhibition of miR-140-3p decreased resistance to oxaliplatin in EC. Therefore, miR-140-3p may serve as a molecular marker for treatment response, efficacy, and prognosis of chemotherapy in ESCC patients.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [2]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is down-regulated in doxorubicin-sensitive cells

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [2]

• Sensitive Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is down-regulated in doxorubicin-sensitive cells

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal carcinoma [ICD-11: 2B70.0] [1]

• Resistant Disease: Esophageal carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: KYSE150 cells; Esophagus; Homo sapiens (Human); CVCL_1348
• In Vitro Model: EC9706 cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: TE1 cells; Esophagus; Homo sapiens (Human); CVCL_1759
• In Vitro Model: ECA-109 cells; Esophagus; Homo sapiens (Human); CVCL_6898
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: It was noticed that the hsa-miRNA-140-3p (miR-140-3p) expression was considerably higher in drug-resistant cells than in sensitive cells. In addition, DGE identified target genes of miR-140-3p might perform key roles in ESCC. Furthermore, this work exhibited that miR-140-3p represents the nuclear transcription factor Y subunit alpha (NFYA) gene by targeting its 3'-untranslated regions. Such an interaction might influence the formation of the transcription factor NFY trimer, which in turn may inhibit the transcription of the multidrug resistance 1 gene and, ultimately, to multidrug resistance in ESCC. The inhibition of miR-140-3p decreased resistance to oxaliplatin in EC. Therefore, miR-140-3p may serve as a molecular marker for treatment response, efficacy, and prognosis of chemotherapy in ESCC patients.

References

• Ref 1: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 2: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.