Molecule Information

General Information of the Molecule (ID: Mol05701)

• Name: hsa-miR-652-3p ,Homo sapiens
• Molecule Type: Mature miRNA
• Sequence: AAUGGCGCCACUAGGGUUGUG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cytarabine

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lymphoblastic lymphoma [ICD-11: 2A70.0] [1]

• Sensitive Disease: Lymphoblastic lymphoma [ICD-11: 2A70.0]
• Sensitive Drug: Cytarabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Pediatric ALL patients; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Drug Sensitivity Assay
• Mechanism Description: Overexpression of miR-652-3p using agomir increased the sensitivity to vincristine and cytarabine (all p<0.05) and promoted apoptosis (both p<0.05) in Reh and RS4:11 cells.

Vincristine

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lymphoblastic lymphoma [ICD-11: 2A70.0] [1]

• Sensitive Disease: Lymphoblastic lymphoma [ICD-11: 2A70.0]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Pediatric ALL patients; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Drug Sensitivity Assay
• Mechanism Description: Overexpression of miR-652-3p using agomir increased the sensitivity to vincristine and cytarabine (all p<0.05) and promoted apoptosis (both p<0.05) in Reh and RS4:11 cells.

References

• Ref 1: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.