Molecule Information

General Information of the Molecule (ID: Mol05401)
Name
hsa-miR-124-1 ,Homo sapiens
Molecule Type
Precursor miRNA
Sequence
AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCAC
GCGGUGAAUGCCAAGAAUGGGGCUG
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [1]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; Luciferase assay
Experiment for
Drug Resistance		 Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is up-regulated in doxorubicin-sensitive cells
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [1]
Sensitive Disease Renal cell carcinoma [ICD-11: 2C90.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; Luciferase assay
Experiment for
Drug Resistance		 Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is up-regulated in doxorubicin-sensitive cells
Paclitaxel
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Laryngeal carcinoma [ICD-11: 2C23.0] [2]
Sensitive Disease Laryngeal carcinoma [ICD-11: 2C23.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration		 Microarray analysis; qRT-PCR
Experiment for
Drug Resistance		 Cell viability assay
Mechanism Description The possible mechanism by which ER-associated genes mediate paclitaxel sensitivity is in that ER is associated with the microtubule cytoskeleton, exactly site where paclitaxel exerts its cytotoxic effect in cancer cells.
References
Ref 1 The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
Ref 2 VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.